ID: 957845162

View in Genome Browser
Species Human (GRCh38)
Location 3:85722204-85722226
Sequence CAGGATAACCAGCTGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 950
Summary {0: 3, 1: 57, 2: 128, 3: 262, 4: 500}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957845162_957845167 16 Left 957845162 3:85722204-85722226 CCTCTCTGCAGCTGGTTATCCTG 0: 3
1: 57
2: 128
3: 262
4: 500
Right 957845167 3:85722243-85722265 GCAGAGAGGAGACCCTGGAGTGG 0: 63
1: 190
2: 248
3: 284
4: 711
957845162_957845168 17 Left 957845162 3:85722204-85722226 CCTCTCTGCAGCTGGTTATCCTG 0: 3
1: 57
2: 128
3: 262
4: 500
Right 957845168 3:85722244-85722266 CAGAGAGGAGACCCTGGAGTGGG 0: 53
1: 127
2: 241
3: 280
4: 630
957845162_957845166 11 Left 957845162 3:85722204-85722226 CCTCTCTGCAGCTGGTTATCCTG 0: 3
1: 57
2: 128
3: 262
4: 500
Right 957845166 3:85722238-85722260 TCTTAGCAGAGAGGAGACCCTGG 0: 4
1: 90
2: 248
3: 256
4: 439
957845162_957845165 2 Left 957845162 3:85722204-85722226 CCTCTCTGCAGCTGGTTATCCTG 0: 3
1: 57
2: 128
3: 262
4: 500
Right 957845165 3:85722229-85722251 GTCTGCTACTCTTAGCAGAGAGG 0: 1
1: 1
2: 15
3: 63
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957845162 Original CRISPR CAGGATAACCAGCTGCAGAG AGG (reversed) Intronic
900235251 1:1586246-1586268 CAGGATGACCAGCTGCAGAGAGG + Intergenic
901056169 1:6449485-6449507 AAGTAGAACCAGCTTCAGAGAGG + Intronic
901403528 1:9031314-9031336 CAGGATGACCAGCTGCAGAGAGG - Intergenic
901936636 1:12631253-12631275 CTGGATGACCAGCTGCAGAGAGG + Intergenic
901957714 1:12798323-12798345 CAGGAAGACCAGTGGCAGAGAGG + Intergenic
902644726 1:17790495-17790517 CGGGACAACAGGCTGCAGAGAGG - Intronic
902788805 1:18751108-18751130 CAGTGTAAACAGCTGCAGTGAGG + Intergenic
903101774 1:21035970-21035992 CAGGATGACCAGCTGTAGAGAGG + Intronic
903337492 1:22634905-22634927 TTGGATGACCAGCTGCCGAGAGG - Intergenic
903395414 1:22998257-22998279 CAGGATACCCAGTTAGAGAGTGG + Intergenic
903672100 1:25042603-25042625 CAGGACAACTAGCTGCAGAGAGG - Intergenic
903672122 1:25042784-25042806 TAGGATGACCAGCTGTAGAGAGG - Intergenic
904042916 1:27594465-27594487 CAGGATGACCAGGTGCCAAGGGG + Intronic
904365709 1:30009905-30009927 TGGGATGACCAGCTGCAGAGGGG - Intergenic
904370118 1:30042904-30042926 TGGGATGACCAGCTGCAGACAGG + Intergenic
904403938 1:30274291-30274313 TGGGAGAACCAGCTGCAGAGGGG - Intergenic
904461068 1:30680074-30680096 TGAGACAACCAGCTGCAGAGAGG + Intergenic
904559994 1:31390120-31390142 CTGGGTAACCAGCTGCCGTGTGG - Intergenic
904577396 1:31513951-31513973 TGGCACAACCAGCTGCAGAGAGG - Intergenic
904732689 1:32606831-32606853 CAGGACTACCAGCTGCAGGAAGG - Intronic
905001326 1:34672007-34672029 CAGGATGACTGGCTGCAGAGAGG + Intergenic
905001336 1:34672075-34672097 TGGGATGACCACCTGCAGAGAGG + Intergenic
905001350 1:34672151-34672173 AAGGATGACCAGCTGCAGAGAGG + Intergenic
905409991 1:37761983-37762005 CAGGACAACTGGCTGCAGACTGG - Exonic
905546094 1:38801590-38801612 CCTGACCACCAGCTGCAGAGAGG + Intergenic
905546106 1:38801660-38801682 CGGGACTACCAGTTGCAGAGAGG + Intergenic
905803069 1:40858040-40858062 CAGGATCAGCAGCTGCAGAAGGG - Intergenic
906132407 1:43468579-43468601 CCCAATGACCAGCTGCAGAGAGG - Intergenic
906652070 1:47519965-47519987 CAGGATAAGCACCTGGAGTGGGG + Intergenic
906854795 1:49292552-49292574 GGGGATGACTAGCTGCAGAGAGG + Intronic
906854811 1:49292690-49292712 CAGGATTACCTGCTGCAGAGAGG + Intronic
906913551 1:49982751-49982773 CAGGACAATCAGCTGTGGAGAGG + Intronic
906938669 1:50236680-50236702 ATGGATAACCAGCCACAGAGAGG - Intergenic
907020221 1:51059749-51059771 CAGGACTACCAGCTGCAGGAAGG + Intergenic
907152984 1:52306256-52306278 CGGGATGACCAGCTGCAGAGAGG + Intronic
907252947 1:53155164-53155186 CTGGATGATCAGCTGCAGAGAGG + Intergenic
907369603 1:53992413-53992435 TGAGACAACCAGCTGCAGAGAGG - Intergenic
907761847 1:57368505-57368527 CTGGATGACCAGCTGCAGAGAGG + Intronic
907985358 1:59524591-59524613 CAGGACTACCAGCTGCAGGAAGG + Intronic
908259289 1:62327245-62327267 CCGGACTACCAGCTGCAGACAGG - Intergenic
908259296 1:62327311-62327333 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
908842111 1:68290535-68290557 CAGTATAACCAGGTGGAAAGAGG - Intergenic
909282340 1:73771036-73771058 TGGGATAACCAGCTGCAGAGAGG + Intergenic
910259901 1:85284505-85284527 TGGGACTACCAGCTGCAGAGAGG + Intergenic
910654915 1:89609776-89609798 TGGGATGACCAGCTGCAGAGAGG - Intergenic
911025043 1:93427081-93427103 CAGGATGACCAGCTGCAGAGAGG + Intergenic
911025053 1:93427149-93427171 TGGGACGACCAGCTGCAGAGAGG + Intergenic
911025063 1:93427219-93427241 TGGGATAACCAGCTGCAGAAAGG + Intergenic
911118623 1:94272447-94272469 CTGGATAACCAGGTGCAAGGAGG + Intronic
911275582 1:95853909-95853931 TGGGATGACCAGCTGCAGAGAGG + Intergenic
911435002 1:97845356-97845378 CAGGACAACCAGCTGTGGAAAGG + Intronic
911540054 1:99146864-99146886 TTGGGTGACCAGCTGCAGAGAGG + Intergenic
912794798 1:112686390-112686412 CAGGATCAAAAGCTGCTGAGGGG - Intronic
912942994 1:114061331-114061353 CAGGATGACCAGCTGCAGAGAGG + Intergenic
914392697 1:147236600-147236622 TGGGACAACCAACTGCAGAGAGG - Intronic
914392717 1:147236741-147236763 TGGGATAACCAGCCGCAGAGAGG - Intronic
914915635 1:151817540-151817562 CAGAGAAAGCAGCTGCAGAGGGG + Intronic
915086413 1:153391854-153391876 CAGGATCACTGGCTGAAGAGAGG + Intergenic
915185065 1:154098530-154098552 TGGGATGACCAGCAGCAGAGAGG - Intronic
915185075 1:154098598-154098620 TTGGGCAACCAGCTGCAGAGAGG - Intronic
916648807 1:166816438-166816460 CAAGATGACCAGCTGCAGAGAGG - Intergenic
917456115 1:175187429-175187451 CATGATAATCACATGCAGAGGGG + Intronic
917817632 1:178725943-178725965 CAGGGTGACCTGTTGCAGAGCGG + Intronic
918963193 1:191306580-191306602 TAGGACGACCAACTGCAGAGAGG - Intergenic
919083218 1:192891235-192891257 TGGGACTACCAGCTGCAGAGAGG - Intergenic
919083224 1:192891301-192891323 TGGGATGATCAGCTGCAGAGAGG - Intergenic
919083229 1:192891346-192891368 CAGGATGACCAGCTGCAGAGAGG - Intergenic
919264033 1:195237993-195238015 CAGGACTACCAGCTGCAGGAAGG + Intergenic
919313954 1:195948184-195948206 CAGGACGACGAGTTGCAGAGAGG - Intergenic
919834183 1:201562491-201562513 CAGGAGGCCCAGCTGCTGAGGGG - Intergenic
921097831 1:211902049-211902071 CAGGATGATCAGCTGCAGAGAGG + Intergenic
921097838 1:211902117-211902139 CAGGATGACCAGCTGCAGAGTGG + Intergenic
921097849 1:211902185-211902207 TGGGACAACCAGCTGCAGAGAGG + Intergenic
921097859 1:211902258-211902280 CAGGATGACCAGCTGCAGAGAGG + Intergenic
921674662 1:217964872-217964894 CAGGACTACCAGCTGCAGGAAGG - Intergenic
921705945 1:218323385-218323407 CAAGACCACCAGCTGCAGCGAGG - Intronic
921752871 1:218817877-218817899 CAGGACAGCCTGCTGCAGGGCGG + Intergenic
921902359 1:220463692-220463714 CAGGCCAATCAGCTGCAGACAGG + Intergenic
922041650 1:221903671-221903693 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
922132774 1:222795661-222795683 TGGGATGAACAGCTGCAGAGAGG + Intergenic
922356253 1:224779174-224779196 GAGGATATCCAGGTGCAGAAAGG - Intergenic
922369237 1:224892876-224892898 CAGGATACCCAGTTAGAGAGTGG - Intergenic
922861339 1:228818883-228818905 CTGGATGGCCAGCAGCAGAGAGG + Intergenic
922861344 1:228818936-228818958 CAGAACAACCATTTGCAGAGAGG + Intergenic
923514584 1:234683976-234683998 CTGGTCAGCCAGCTGCAGAGGGG + Intergenic
923755311 1:236786043-236786065 CAGGACAACCAGCTGCAGAGGGG + Intergenic
924412086 1:243817065-243817087 CAGGATGACCTGCTAGAGAGAGG + Intronic
924679924 1:246220858-246220880 TGGGACAACCAGCTGCAGAGAGG + Intronic
924679946 1:246220998-246221020 TGGGACGACCAGCTGCAGAGAGG + Intronic
1062770014 10:91964-91986 TAGGACAACCAGCTGCAGAGAGG - Intergenic
1063095139 10:2902586-2902608 CAGAATGACCAGCTCTAGAGTGG + Intergenic
1063990601 10:11557900-11557922 CAAGATAACCAGCTGAAAATAGG + Intronic
1065108925 10:22420930-22420952 CAGGAGAACCAGCAGCAGGTTGG + Intronic
1065407898 10:25389283-25389305 TGGGACAACCAACTGCAGAGAGG + Intronic
1065806140 10:29395057-29395079 CAGGATTACCAGCTGCTGGAAGG + Intergenic
1067018069 10:42772252-42772274 CAGGACAACTAGCTACAGAGAGG + Intergenic
1067018079 10:42772315-42772337 CATGATGACCAGCTGCAGGGAGG + Intergenic
1067288107 10:44922084-44922106 CCGGATAACTAGGAGCAGAGTGG - Intronic
1067715796 10:48690614-48690636 AGGGACAACCAGCTGCAGAGAGG - Intronic
1067715811 10:48690736-48690758 CTGGATGACCAGCTGCAGGGAGG - Intronic
1068060575 10:52063806-52063828 TGGGATGACCAGCTGCAGAGAGG - Intronic
1068060585 10:52063874-52063896 TGGGATGACCAGCTGCAGAGAGG - Intronic
1068083614 10:52347846-52347868 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1068222708 10:54064255-54064277 CAAGAATACCAGCTGCAGGGAGG - Intronic
1068279858 10:54854599-54854621 CAGGATGATCAGCTGCAGAGAGG - Intronic
1068279866 10:54854667-54854689 CCTGATGATCAGCTGCAGAGAGG - Intronic
1068283652 10:54908931-54908953 CAGGATGACCAGCTGCAACAAGG - Intronic
1068348499 10:55814011-55814033 CGGGATGCCCAGCTGCAGAATGG + Intergenic
1069156293 10:65034808-65034830 CAGGATGACCAGCTGTGGAGAGG + Intergenic
1069592989 10:69653239-69653261 TGGGACAATCAGCTGCAGAGAGG + Intergenic
1070692845 10:78540507-78540529 CAGCAGAAGCAGCTGCACAGGGG + Intergenic
1070859327 10:79638163-79638185 TGGGACGACCAGCTGCAGAGAGG - Intergenic
1071060863 10:81570197-81570219 TGGGATGACCAGCTGCAGAAAGG - Intergenic
1071886015 10:89951552-89951574 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1071886034 10:89951715-89951737 TGGGACAATCAGCTGCAGAGAGG - Intergenic
1071957106 10:90771026-90771048 CAGGACCACAAGCTGCAGAAAGG + Intronic
1071957112 10:90771082-90771104 CGGGATGACCAGCTGCAGACAGG + Intronic
1072335525 10:94395094-94395116 CAAGATGACCAGCTTCAGAGAGG - Intergenic
1072436697 10:95420750-95420772 GAGGATAAGCATCTGTAGAGAGG + Intronic
1072753338 10:97999825-97999847 CAGGACGACCAGCTGCAAAGAGG + Intronic
1072753363 10:97999965-97999987 TGGAATGACCAGCTGCAGAGAGG + Intronic
1072962371 10:99940859-99940881 CAGGATCAGAAGCTGCCGAGAGG - Intronic
1073230665 10:101966827-101966849 AAGGTAAACCAGGTGCAGAGAGG + Intronic
1073323465 10:102629409-102629431 CAGGGTTACCAGCCTCAGAGTGG - Intronic
1073670223 10:105579705-105579727 CAGTACAACCAGCTGCAGAGAGG - Intergenic
1073733609 10:106320476-106320498 CAGGACAACCAGCTACAGAGAGG + Intergenic
1074028794 10:109663913-109663935 TGGGATGACCAGCTACAGAGAGG + Intergenic
1074028820 10:109664098-109664120 TAGGATGACCAACTGCAGGGAGG + Intergenic
1074247910 10:111713477-111713499 CAGGATGACCAGCTCCAGAGAGG - Intergenic
1074247921 10:111713591-111713613 TGGGATGACCAGCTGTAGAGAGG - Intergenic
1074991512 10:118712684-118712706 TGGGACGACCAGCTGCAGAGAGG - Intronic
1074991520 10:118712754-118712776 TGAGATGACCAGCTGCAGAGAGG - Intronic
1075007827 10:118842996-118843018 TGGGATGACCAGCTGCAGGGAGG + Intergenic
1075007837 10:118843066-118843088 TGGGAAGACCAGCTGCAGAGAGG + Intergenic
1075206952 10:120456819-120456841 CAGGACCAGGAGCTGCAGAGGGG + Intergenic
1075222470 10:120597128-120597150 CAGGATAACCAGCTGAAGATTGG - Intergenic
1076549120 10:131266837-131266859 CAGGATGACCAGCTGCAGAGAGG - Intronic
1077012835 11:386427-386449 CGGGATGACCAGCTGCAGAAAGG + Intergenic
1077382399 11:2250240-2250262 CAGGCCAAGGAGCTGCAGAGAGG + Intergenic
1077555664 11:3224907-3224929 CATGATGCCCAGCTGGAGAGAGG - Intergenic
1077844674 11:6012385-6012407 TGGGATGACCAGGTGCAGAGAGG - Intergenic
1077975940 11:7249255-7249277 CAGGATATCTTGCTGGAGAGGGG - Intronic
1078042738 11:7883786-7883808 CAGGATGACCAGTTGCAGAGAGG - Intergenic
1078042755 11:7883909-7883931 TGAGATGACCAGCTGCAGAGAGG - Intergenic
1078042758 11:7883963-7883985 CTGGATGATCAGCCGCAGAGAGG - Intergenic
1078315127 11:10288486-10288508 TGGGATGACCAGCTGCAGAGAGG - Intronic
1078315134 11:10288542-10288564 CAGGACAACCAGCTGCAGAGAGG - Intronic
1078599999 11:12721830-12721852 CAGGAAAACCTGCTGGACAGTGG - Intronic
1079168704 11:18071209-18071231 AAGGAAAAACAGCTGGAGAGAGG + Intronic
1079184100 11:18221049-18221071 CAGGACAACCAGCTGTGGAGAGG - Intronic
1079472288 11:20789956-20789978 CAGAAGGACCAGCTGCAGAGAGG - Intronic
1079710672 11:23679698-23679720 AGGGATGACCAGCTGCGGAGAGG - Intergenic
1079733270 11:23962348-23962370 CGGGACCACCAGCTGCAGAGAGG + Intergenic
1079882296 11:25943673-25943695 ATGGAAGACCAGCTGCAGAGAGG - Intergenic
1080583954 11:33665489-33665511 TGGGACAACCAGCAGCAGAGAGG - Intronic
1080966972 11:37224573-37224595 TGGGACAACCAGCTGCAGAAAGG - Intergenic
1081163931 11:39785805-39785827 CAGGATCACCAGCTGCAGAGAGG - Intergenic
1081268625 11:41057792-41057814 TGGGACAACCAGCTGCAGAAAGG + Intronic
1081672096 11:44948192-44948214 CAGGAGAGGCAGCTGCAGGGCGG - Intronic
1081759640 11:45568244-45568266 CTGGTAAAGCAGCTGCAGAGGGG - Intergenic
1082843379 11:57707720-57707742 AAGGATAACCATCTGGACAGAGG - Intronic
1082854776 11:57796681-57796703 CTGGATAACCATCTTCATAGTGG - Exonic
1083066761 11:59931971-59931993 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1084469457 11:69348590-69348612 CAGGATGACCAGCTGCAGCTGGG - Intronic
1084991165 11:72926431-72926453 TGGGATGGCCAGCTGCAGAGAGG + Intronic
1085100647 11:73797112-73797134 CGGGACAACCGGCTGCAGAGAGG + Intronic
1085110555 11:73883980-73884002 CATGAGAACCAGCTGCTGTGGGG + Intronic
1085320515 11:75571242-75571264 CAGAATAATCAGATGCAGGGGGG - Intronic
1086085059 11:82945432-82945454 CAGGACAACCAGCAGTAGAAAGG - Intronic
1086092803 11:83020941-83020963 CAGGATGACCAGCTGCAGAGAGG + Intronic
1087726086 11:101719000-101719022 CAGGAGTCCCAGGTGCAGAGGGG - Intronic
1088135685 11:106552831-106552853 TGGGACACCCAGCTGCAGAGAGG + Intergenic
1088135691 11:106552887-106552909 CAGGATGACCAGCTGCGGAGAGG + Intergenic
1088345733 11:108822688-108822710 CGGGACATCCAGCTTCAGAGAGG - Intronic
1088500695 11:110479550-110479572 CATGATAACAAGCTGCAGATTGG + Intergenic
1088513304 11:110599744-110599766 CCTGACAACCAGCTGCAGAGAGG + Intronic
1088704246 11:112447683-112447705 TGGGACAACCAACTGCAGAGAGG - Intergenic
1088704254 11:112447754-112447776 CCTAATGACCAGCTGCAGAGAGG - Intergenic
1089398009 11:118148424-118148446 CAGGATGACCAAGTCCAGAGAGG + Intronic
1089822505 11:121241314-121241336 CCAGACCACCAGCTGCAGAGAGG - Intergenic
1089823201 11:121246798-121246820 TGGGATGACCCGCTGCAGAGAGG + Intergenic
1090124869 11:124075343-124075365 TGGGATGACCTGCTGCAGAGAGG - Intergenic
1090124873 11:124075399-124075421 CAGGATGATCAGCAGCAGAGAGG - Intergenic
1090136982 11:124209397-124209419 CTGGGTGACCACCTGCAGAGAGG - Intergenic
1090137010 11:124209581-124209603 TGAGATGACCAGCTGCAGAGAGG - Intergenic
1090305939 11:125691140-125691162 CATGATAAACAGATGAAGAGAGG - Intergenic
1090514594 11:127411973-127411995 TGGGACAGCCAGCTGCAGAGAGG - Intergenic
1092191991 12:6528044-6528066 CAAGTGAAGCAGCTGCAGAGAGG - Exonic
1092337738 12:7648617-7648639 CTGGATGACCAGATGCAGAGAGG - Intergenic
1092447070 12:8567850-8567872 CTGGACAACCAGCTGCAAAGAGG - Intergenic
1092501432 12:9051264-9051286 CGGGATTACCAGCTGCAGAGAGG + Intergenic
1092501450 12:9051393-9051415 TGGGAAGACCAGCTGCAGAGAGG + Intergenic
1092508139 12:9125060-9125082 TGGGACAACCAGCTGCACAGAGG + Intergenic
1093281833 12:17204343-17204365 TGGGATGACCAGCTACAGAGGGG + Intergenic
1093492987 12:19725956-19725978 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1093914917 12:24790584-24790606 CTGGTAAACCAGCTGCAGTGAGG + Intergenic
1094018115 12:25885136-25885158 CGGGATTACCAGCTGCAGAAAGG + Intergenic
1094144506 12:27214421-27214443 CAGGAGGACTAGCTGCAGAGAGG + Intergenic
1095145431 12:38721241-38721263 CAGGACTGCCAGCTGCAGAAAGG + Intronic
1095603220 12:44037807-44037829 CAGGACTACCAGCTGCAGAGAGG + Intronic
1095603236 12:44037908-44037930 TGGGAGTACCAGCTGCAGAGAGG + Intronic
1095727526 12:45469633-45469655 GGAGACAACCAGCTGCAGAGAGG + Intergenic
1095826131 12:46531615-46531637 CAGGATGACCATCTGCAGAGAGG + Intergenic
1096171972 12:49479072-49479094 AGGGACAACCTGCTGCAGAGAGG - Intronic
1096387645 12:51205338-51205360 CAGGATAAAAAGCTGCAGTCAGG - Intronic
1096602150 12:52736967-52736989 CAGGACGACGAGCTGCAGAGAGG - Intergenic
1096602157 12:52737021-52737043 AAGGAGGACCAGCTGCAGAGAGG - Intergenic
1096602901 12:52742712-52742734 AGGGAGGACCAGCTGCAGAGAGG + Intergenic
1096602907 12:52742766-52742788 CAGGACGACGAGCTGCAGAGAGG + Intergenic
1096780860 12:53991411-53991433 CAGGGGACCCAGCTCCAGAGTGG + Intronic
1096815934 12:54201726-54201748 CAGGGTCACCAGATGGAGAGCGG - Intergenic
1097130834 12:56809790-56809812 CGAGACAACCACCTGCAGAGAGG - Intergenic
1097130857 12:56809953-56809975 CGGGACAACCAGCTGCAGAGAGG - Intergenic
1097140660 12:56900172-56900194 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1097298947 12:57997867-57997889 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1097298971 12:57998031-57998053 CAGGAGGACCAGCTTCAGAGTGG - Intergenic
1097491967 12:60282325-60282347 CAGGATGATCAGCTGCGGAGAGG - Intergenic
1098143858 12:67478280-67478302 CTGAATAACCAGCTGAAGAGGGG - Intergenic
1098465606 12:70783433-70783455 CAGAATGATCAGCTACAGAGAGG - Intronic
1099982132 12:89616877-89616899 CAGGAGAACCAGAACCAGAGTGG - Exonic
1100672813 12:96835282-96835304 TCGGACAACCAGGTGCAGAGAGG - Intronic
1100847930 12:98679206-98679228 TGGGACAACCAGCTGCAGAGAGG + Intronic
1100847940 12:98679276-98679298 CAGGAGGACCAGCTGCAGAGAGG + Intronic
1102060451 12:109926990-109927012 CGGGACAACCAGCTGCAGAGAGG + Intronic
1104805573 12:131587177-131587199 AAGGACGACCAGCTGCAGAGAGG + Intergenic
1104908612 12:132228763-132228785 CAGGAAAGCCATCTGCAGAGCGG - Intronic
1105048582 12:133027802-133027824 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1106265674 13:28107547-28107569 CAGGAGAGCCAACTGCAGATGGG - Intergenic
1106308945 13:28535723-28535745 CGGGATGACCAGCTGCAGAGAGG + Intergenic
1106308950 13:28535775-28535797 AAGGACAACCAGCTGCAGAAAGG + Intergenic
1106308965 13:28535894-28535916 CTGGAGGACCAGCAGCAGAGAGG + Intergenic
1106316178 13:28596048-28596070 AAAGATAAGCAACTGCAGAGTGG - Intergenic
1106316295 13:28596841-28596863 CAAGATAAGCAACTGCAGAGTGG - Intergenic
1107147077 13:37070500-37070522 CGGGATGACCAGCTGCAGAGAGG + Intergenic
1107450070 13:40500310-40500332 CGAGATAACAAGCGGCAGAGGGG + Intergenic
1107853482 13:44592297-44592319 CAGGAGGACCAGCTGCAAAGAGG + Intergenic
1107875796 13:44789751-44789773 CAGGATGAGCAGCTGCAGAGAGG - Intergenic
1108240295 13:48457302-48457324 CAGGACGAGCAGCTGCAGAGAGG - Intronic
1108407100 13:50115468-50115490 CAGGAGTACCAGCAGCAGATGGG + Intronic
1108686734 13:52826400-52826422 CCGGACCAGCAGCTGCAGAGGGG + Intergenic
1109470672 13:62799729-62799751 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1109525274 13:63566709-63566731 CCAGACGACCAGCTGCAGAGAGG + Intergenic
1109562819 13:64075686-64075708 CAGGACTACCAGCTGCAGAGAGG - Intergenic
1109622177 13:64925229-64925251 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1109633681 13:65085722-65085744 CTGGACAACCAACTGCGGAGAGG - Intergenic
1110624494 13:77637632-77637654 GGGGATCACCAGCAGCAGAGGGG - Intronic
1110810686 13:79808029-79808051 CAGGTCTACCAACTGCAGAGAGG + Intergenic
1110939472 13:81330944-81330966 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1110939478 13:81331006-81331028 TGGGACTACCAGCTGCAGAGAGG + Intergenic
1111237814 13:85431537-85431559 CAGAATGACCAGCTGAGGAGAGG + Intergenic
1111337226 13:86840056-86840078 CATGATGACCAGCTGTAGAGAGG - Intergenic
1111512646 13:89287156-89287178 TGGGATGAGCAGCTGCAGAGAGG - Intergenic
1111512658 13:89287226-89287248 CAGGACTACTAGCTGCAGAGAGG - Intergenic
1111800449 13:92974613-92974635 CAGGACAACCAGTTGCAGAGAGG - Intergenic
1112086231 13:96034784-96034806 CAGGAGTGCCAGCTGCAGTGGGG - Intronic
1113339182 13:109404944-109404966 GGAGACAACCAGCTGCAGAGAGG + Intergenic
1113970723 13:114186190-114186212 CAGGATGACCAGCTACAGAGGGG + Intergenic
1113970733 13:114186257-114186279 CAGGACAACCAGCTTCAGGGAGG + Intergenic
1114281074 14:21192751-21192773 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1114349550 14:21835448-21835470 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1114349557 14:21835516-21835538 CAGGATGACCAGCAGCAGAAAGG - Intergenic
1115485027 14:33901937-33901959 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1116131431 14:40859437-40859459 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1116257247 14:42571514-42571536 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1116541487 14:46107429-46107451 CAGAATGACCAGCTGTGGAGAGG - Intergenic
1117954625 14:61112947-61112969 CAACAGAGCCAGCTGCAGAGGGG - Intergenic
1118063464 14:62165693-62165715 CAGCATTACCAGGTGCTGAGTGG - Intergenic
1118200077 14:63663507-63663529 CAGGATGACCAGCTATGGAGAGG - Intergenic
1118410063 14:65469762-65469784 CCAGATGACTAGCTGCAGAGAGG - Intronic
1118746666 14:68779018-68779040 CAGGACAAACAGCCGGAGAGGGG + Intergenic
1118946990 14:70398115-70398137 TGGGATGACCAGCTCCAGAGAGG - Intronic
1119036212 14:71231977-71231999 CACGCCGACCAGCTGCAGAGAGG + Intergenic
1119168647 14:72516028-72516050 CAGGAGAACCAGGTTCACAGAGG - Intronic
1120405744 14:84091464-84091486 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1120590063 14:86364270-86364292 CAAGACAACCAGCTGCAGAGAGG + Intergenic
1120745529 14:88147631-88147653 GAGGAGGACCAGCTGCAGAGAGG + Intergenic
1120829322 14:88984143-88984165 CAGGATCACCAGCTGCTCAGTGG - Intergenic
1120847898 14:89142343-89142365 CAGGAACACTAGGTGCAGAGTGG + Intronic
1121397957 14:93643661-93643683 CATGATATCCAGCAGCAGCGGGG - Exonic
1121695321 14:95907866-95907888 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
1121974083 14:98386043-98386065 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1121974089 14:98386096-98386118 TGGGACAACCAGCTACAGAGAGG + Intergenic
1122131449 14:99606218-99606240 CAAGAGAACCAGCTCCTGAGGGG + Intergenic
1122439419 14:101719790-101719812 CTGGATAAACACCTGAAGAGGGG + Intergenic
1123216585 14:106813789-106813811 CAGGACGACCAGCTGCAGGGAGG + Intergenic
1123216596 14:106813845-106813867 CAGGACGACCAGCTGCAGGGAGG + Intergenic
1123216608 14:106813901-106813923 CAGGACGACCGGCTGCAGGGAGG + Intergenic
1124650206 15:31468890-31468912 TGGGATGACCAACTGCAGAGAGG - Intergenic
1124820893 15:33044635-33044657 GAGGATGACCAGCTGCAGAGAGG + Intronic
1124820913 15:33044773-33044795 CAGGATGACCAGCTGTACAGAGG + Intronic
1124937612 15:34187069-34187091 GAGGACAATCAGCTGCAGAGTGG + Intronic
1124937617 15:34187122-34187144 TGGGACCACCAGCTGCAGAGAGG + Intronic
1125381551 15:39092188-39092210 TGGGATTACCAGCTGCAGAGAGG - Intergenic
1125381562 15:39092258-39092280 CGGGAGGACCAGCTGCAGAGAGG - Intergenic
1125436081 15:39646169-39646191 TGGGAAGACCAGCTGCAGAGAGG + Intronic
1125752398 15:42037370-42037392 CAGGATGACCAGCTGCTGAGAGG + Intronic
1126156856 15:45574042-45574064 CAGGATGGCCAGCTGCATAGAGG - Intergenic
1127525891 15:59791886-59791908 CAGGACGACCAGCTGCAGAGAGG - Intergenic
1128466840 15:67919672-67919694 GAGGGTAAACAACTGCAGAGAGG - Intergenic
1128847878 15:70917436-70917458 TGGGATAACCAGCTGTAGAGAGG + Intronic
1128847887 15:70917506-70917528 TGGGATGACCATCTGCAGAGAGG + Intronic
1129377704 15:75144677-75144699 CATGATGACCAGCTGCAGAGAGG - Intergenic
1129377708 15:75144733-75144755 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1129800007 15:78406372-78406394 CTGGACTACCAGCTGGAGAGAGG + Intergenic
1130028966 15:80295012-80295034 TAGGATGACCAGCTGCAGAGAGG - Intergenic
1130183193 15:81651906-81651928 CAGGATGACCTGCTGCAGAAAGG + Intergenic
1132305368 15:100807996-100808018 CAGGACAACTGGCTGCAGAGAGG + Intergenic
1132548774 16:545656-545678 CAGCCTCACCAGCTCCAGAGAGG - Intronic
1133544188 16:6789015-6789037 CAGGAGAACCATCTTCAGACTGG - Intronic
1136628207 16:31474397-31474419 CAGTCTATCCAGCTCCAGAGTGG - Exonic
1136872797 16:33824122-33824144 CAGGACGACTAGCTGCAGGGAGG - Intergenic
1136872806 16:33824178-33824200 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1136872813 16:33824234-33824256 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1136872821 16:33824290-33824312 CAGGAAGACCAGCTGCAGGGAGG - Intergenic
1137238221 16:46633158-46633180 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1137256424 16:46778624-46778646 CAGGATGATCAGCTGCAGAGAGG + Intronic
1137256431 16:46778677-46778699 TGGGACAACCACCTGCAGAGAGG + Intronic
1137334290 16:47533120-47533142 CAGGACAACCAGGTGCAGAGAGG - Intronic
1137334297 16:47533188-47533210 CGGGATGACTAGCTGCAGAGAGG - Intronic
1137698406 16:50478359-50478381 CTGGACGACCAGCTGCAGAGAGG - Intergenic
1138033501 16:53579920-53579942 CAGAATGACCAGCTACAGAGAGG - Intergenic
1138033513 16:53579988-53580010 TGGGATGACCAGCTACAGAGAGG - Intergenic
1138394824 16:56695765-56695787 CAGGACAACCACCTGCAGAAAGG + Intronic
1138394845 16:56695888-56695910 CAGGACAACCAGTAGCAGAGAGG + Intronic
1139392822 16:66615982-66616004 CAGGAGAAGCAGCAGCAGAGAGG + Exonic
1139625805 16:68187679-68187701 CAGGATGACCAGCTGTGGAGAGG - Intronic
1140419539 16:74807302-74807324 GGGGATAACTACCTGCAGAGAGG - Intergenic
1141026478 16:80553572-80553594 CAGGAAATGAAGCTGCAGAGTGG + Intergenic
1141474218 16:84261508-84261530 AAGGATGCCAAGCTGCAGAGAGG + Intergenic
1142202235 16:88766770-88766792 CAGGATCACCAGCCCCAGAACGG + Intronic
1203099350 16_KI270728v1_random:1291764-1291786 CAGGAAGACCAGCTGCAGGGAGG + Intergenic
1203099358 16_KI270728v1_random:1291820-1291842 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1203099365 16_KI270728v1_random:1291876-1291898 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1203099374 16_KI270728v1_random:1291932-1291954 CAGGACGACCAGCTGCAGGGAGG + Intergenic
1143870730 17:9955916-9955938 CAGGAACCCCAGCTGCACAGTGG - Intronic
1144060899 17:11582873-11582895 CAGGATGACCAGCTACAGAGAGG - Intergenic
1144060905 17:11582929-11582951 GGGGACAACCAGCTGCAGAGAGG - Intergenic
1144386297 17:14751620-14751642 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1144695514 17:17301479-17301501 GGAGAAAACCAGCTGCAGAGAGG + Intergenic
1144714533 17:17424728-17424750 TGGGAAAACCAGCTGCAGAGAGG + Intergenic
1146459475 17:33033934-33033956 CAGGACGACCAGCTGCAGAGAGG + Intronic
1146761540 17:35483028-35483050 CAGGACAACCAGCCGCAGAGTGG + Intronic
1148038403 17:44686493-44686515 CAGGAAAAGGAGCAGCAGAGAGG + Intronic
1148386252 17:47237256-47237278 GGAGATGACCAGCTGCAGAGAGG - Intergenic
1148386269 17:47237336-47237358 GGTGATGACCAGCTGCAGAGAGG - Intergenic
1148640379 17:49183333-49183355 CAGGGCAACCAGCTGCAGAGAGG - Intergenic
1148640390 17:49183403-49183425 CAGGACGAACAGCTGCAGAGAGG - Intergenic
1149088728 17:52751668-52751690 CAGGACAATCAACTGCAGAGAGG + Intergenic
1149160387 17:53686750-53686772 CTGGATGACAAGCTGCAGAGAGG - Intergenic
1149482885 17:57017840-57017862 CAGGATGACCAGTTGCAGAGTGG - Intergenic
1149482890 17:57017894-57017916 CAGGATGATCAGCTGCAGAGAGG - Intergenic
1150529172 17:65958955-65958977 GGGGACAACCAGCTGCAGAGGGG + Intronic
1150529182 17:65959023-65959045 CAGGACAACCAGCTGCAGAGAGG + Intronic
1150529193 17:65959093-65959115 CGGGACCACCAGCTGCAGATAGG + Intronic
1150634859 17:66905750-66905772 CAGGATAGCAAGCAGGAGAGTGG + Intergenic
1150673314 17:67221586-67221608 CAGGCTATGCAGCTGGAGAGTGG - Intronic
1150951000 17:69802013-69802035 CAGGATGACCAGCTACAGAGAGG + Intergenic
1150951010 17:69802083-69802105 TGGGATGACCAGCTGGAGAGAGG + Intergenic
1150952838 17:69822003-69822025 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1151010010 17:70483661-70483683 CAGGATGGCCAGCTGTGGAGAGG - Intergenic
1151010036 17:70483797-70483819 CTGGACGACCAGCTGCAAAGAGG - Intergenic
1151395262 17:73819139-73819161 CAGGACAACCAGTTGCAGAGAGG - Intergenic
1151395267 17:73819193-73819215 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1151541493 17:74767193-74767215 CAGGATGGCGGGCTGCAGAGGGG - Intronic
1151773115 17:76177743-76177765 TGGGACCACCAGCTGCAGAGAGG + Intronic
1151895179 17:76975168-76975190 CAGGACAGCCGGCTGCAGAGAGG + Intergenic
1151980336 17:77504621-77504643 AAGCAGAACCAGCTGCATAGGGG + Intergenic
1152248056 17:79196176-79196198 CTGGAGAAACAGCAGCAGAGTGG + Intronic
1152530395 17:80915109-80915131 TGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530403 17:80915179-80915201 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530412 17:80915247-80915269 CGGGAAAACCAGCTGCGGAGAGG + Intronic
1152530421 17:80915317-80915339 CAGGAAAACCAGCTGCAGAGAGG + Intronic
1152530430 17:80915387-80915409 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530439 17:80915457-80915479 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530449 17:80915527-80915549 CGGGAAAACCAGCTGCGGAGAGG + Intronic
1152530460 17:80915597-80915619 CGGGAAAACCAGCTGCGGAGAGG + Intronic
1152530470 17:80915667-80915689 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530481 17:80915737-80915759 CGGGAAAACCAGCTGCGGAGAGG + Intronic
1152530492 17:80915807-80915829 CGGGAAAACCAGCTGCGGAGAGG + Intronic
1152530502 17:80915877-80915899 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152584450 17:81182764-81182786 CAGGACAAACAGCTCCAGCGTGG + Intergenic
1152713168 17:81885041-81885063 CAGGACAGCCAGAGGCAGAGGGG + Intergenic
1152764373 17:82128050-82128072 CAGGAGAGGCAGCTGCAGACAGG + Intronic
1154096091 18:11416546-11416568 GAGGCTGAGCAGCTGCAGAGAGG - Intergenic
1154507968 18:15061087-15061109 GCAGATAACCAGCTGCAGAGAGG + Intergenic
1154507975 18:15061145-15061167 AGGGACAACCAGCGGCAGAGAGG + Intergenic
1155120644 18:22816061-22816083 CAGGATGACCAGTTGCAGAGAGG - Intronic
1155120660 18:22816187-22816209 TGGGATGACCAGTTGCAGAGAGG - Intronic
1155526646 18:26722362-26722384 CAGGATAAGCCACTGCAGTGGGG + Intergenic
1155819208 18:30353119-30353141 CAGGACTACCAGCTGCAGGAAGG + Intergenic
1155830861 18:30513666-30513688 CAGGACAACCAGTAGTAGAGAGG - Intergenic
1155830866 18:30513721-30513743 ATGGATAACCAGCTGCAGAGAGG - Intergenic
1156298756 18:35817593-35817615 GGGGACAACCAGCTGCAGAGAGG - Intergenic
1156327305 18:36085760-36085782 CAAGACGACCAGCTGCAGAGGGG + Intergenic
1156380792 18:36559301-36559323 CAAGAGAAGCAGCCGCAGAGAGG - Intronic
1157042866 18:44060937-44060959 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1157524630 18:48371569-48371591 CAGGATAACCAGGAAGAGAGTGG + Intronic
1159186702 18:64984178-64984200 TAGGACAACCAGCTGCAGAGAGG + Intergenic
1159519055 18:69495476-69495498 TGGGACAACCAGCTGCAGAGAGG - Intronic
1160292859 18:77609654-77609676 CTGGATGACCAGCTGCAGAGAGG + Intergenic
1160848361 19:1177139-1177161 CAGGATAACCACTTGAACAGGGG - Intergenic
1161173185 19:2823714-2823736 CCGGACGACCAGCTGCAGAGAGG - Intronic
1161543844 19:4867908-4867930 CAGGGTCCCCAGCTGCGGAGCGG - Intergenic
1161780214 19:6286707-6286729 CGGGACTACCAGCTGCAGAGAGG + Intergenic
1162287592 19:9751044-9751066 CAGGATACCCAGTTAGAGAGTGG - Intergenic
1162993786 19:14320525-14320547 CCGGTAAGCCAGCTGCAGAGAGG + Intergenic
1165022656 19:32936643-32936665 TGAGATGACCAGCTGCAGAGAGG + Intronic
1165291999 19:34893439-34893461 CAGGAGAACCAGCTGAAGCTGGG + Intergenic
1166897511 19:46033057-46033079 TGGGACAACCAGCTGCAGAGCGG + Intergenic
1166898174 19:46036940-46036962 CAGGATGAACAGCTGCAGATAGG + Intergenic
1167346275 19:48947351-48947373 CAGGATGACCAGCTACAGAGCGG + Intergenic
1167510077 19:49891165-49891187 CAGGAGGCCCAGCTGCGGAGGGG - Intronic
1168551760 19:57302194-57302216 CTGGATAACCAGCTGCCAGGGGG - Intergenic
924963907 2:58157-58179 TGGGATGACCAGCTGCAGGGAGG + Intergenic
925048209 2:790320-790342 CTGGATGACCTGCTGCAGAGAGG + Intergenic
925067987 2:943987-944009 CAGGAGGAACTGCTGCAGAGAGG - Intergenic
925515334 2:4674917-4674939 CAGGATGACCCGCTGTGGAGAGG + Intergenic
925553684 2:5104990-5105012 CAGGAGCACCAGCTGGAGGGAGG + Intergenic
926620329 2:15041426-15041448 CAAGAGAAACAGCTGCAGGGTGG + Intergenic
926625469 2:15086207-15086229 CAGGAAGACCAGTTGCAGAGAGG + Intergenic
926953637 2:18271394-18271416 CGGGAGGACCAGTTGCAGAGAGG - Intronic
927072942 2:19548717-19548739 TGGGATGACCAGCTGCAGAAAGG + Intergenic
927226228 2:20767956-20767978 TGGGATGACCAGCTGCAGAGAGG + Intronic
927236437 2:20879872-20879894 CAGGACTACCAGCTGCGGAAAGG - Intergenic
927266861 2:21161935-21161957 TAGGACAACCAGCTACAGAGAGG - Intergenic
927533815 2:23836717-23836739 CAGGATGACCAGCTGCAGAGAGG - Intronic
927533827 2:23836785-23836807 CAGGAGGACCAACTTCAGAGAGG - Intronic
927613538 2:24566298-24566320 TGGGATGACCAGCTGCGGAGAGG - Intronic
927613560 2:24566438-24566460 TAGGATGACCAGCTGTGGAGAGG - Intronic
927743155 2:25590569-25590591 TGGGACAACCAGCTGCAGAGAGG - Intronic
928840511 2:35599353-35599375 CAGGATGACCAGCTGCAGAGAGG + Intergenic
929492482 2:42408445-42408467 CAGGATGACCAGCTGCAGAGAGG + Intronic
930612046 2:53554404-53554426 TGGGATGACCAGCTGCAAAGAGG + Intronic
930612060 2:53554518-53554540 TGGGATGACCAGCTGCAGAAAGG + Intronic
930800586 2:55438657-55438679 TGGGAAAACCAGCTGCAGAGAGG + Intergenic
930957289 2:57217698-57217720 CAGGATGACCAGCTGTGGAGAGG + Intergenic
930957301 2:57217835-57217857 CAGGACTACCAGCTGCAGAGAGG + Intergenic
931046365 2:58358313-58358335 AAGGATAATCAGATGCAGATAGG - Intergenic
931222393 2:60299464-60299486 GAGGAGCACAAGCTGCAGAGTGG - Intergenic
932485345 2:72081148-72081170 TGGGACAGCCAGCTGCAGAGAGG + Intergenic
932501613 2:72187620-72187642 CAGGACGACCAGCTGCAGAGAGG - Intronic
932522472 2:72427929-72427951 TGGGACAACCAGCTGAAGAGAGG + Intronic
933093325 2:78146924-78146946 TGGGATGACTAGCTGCAGAGAGG + Intergenic
933624672 2:84585624-84585646 CGGGAAAACCAGCTGCAGAGGGG - Intronic
933801123 2:85961227-85961249 CAGGATGACCAGCTGCAGAAAGG - Intergenic
934699901 2:96430789-96430811 CAGTATGACCAGCTGCAGAGAGG + Intergenic
935514983 2:104024910-104024932 CTTGATAACCTGCTGGAGAGGGG - Intergenic
935518731 2:104078173-104078195 CAGGACGACAAGCTGCAGAGAGG - Intergenic
937163988 2:119794978-119795000 TGGGATAGCCAGCTGCAGAGTGG - Intronic
937164006 2:119795104-119795126 TGGGACAACCAACTGCAGAGAGG - Intronic
937254728 2:120547127-120547149 CAGTTTTCCCAGCTGCAGAGTGG - Intergenic
937285104 2:120745779-120745801 CAGGTGAACCAGCTGCAGGGTGG - Intronic
937543757 2:122989660-122989682 CAGGATGACCAGCTGCAGAGGGG + Intergenic
938180631 2:129179088-129179110 CAGGATGACCAGCTTCAGAGGGG - Intergenic
939991064 2:148876640-148876662 CAGCAGCCCCAGCTGCAGAGAGG - Intronic
940396253 2:153195987-153196009 CAGGATAGCCAGCTGCAGAGAGG - Intergenic
940612174 2:156006254-156006276 TGGGACAACCAGCTGCAGAGAGG - Intergenic
941736630 2:168984191-168984213 CAGGATAACCAGGTGTGGCGGGG - Intronic
942104030 2:172614451-172614473 CGGGATGACCAGCTGCAGAGAGG + Intergenic
943182319 2:184560296-184560318 CAGGACTACCAGCTGCAGAGAGG - Intergenic
943426968 2:187749729-187749751 CAGGATGACCAGATGTGGAGAGG - Intergenic
943426975 2:187749800-187749822 CAGGACAAACAGCTGCAGAGAGG - Intergenic
943526307 2:189021053-189021075 CAGGACAACCAACTGCAGAGAGG + Intergenic
943820398 2:192314641-192314663 CAGGACAACCAGCTGCAGAGAGG - Intergenic
943961236 2:194265342-194265364 TGGGATGACAAGCTGCAGAGAGG + Intergenic
944483855 2:200182669-200182691 TGGGAAAACCAGCTGCAGAGAGG + Intergenic
944483861 2:200182735-200182757 CGGTACTACCAGCTGCAGAGAGG + Intergenic
944586696 2:201179105-201179127 TGGGATGACCAGCTGCAGAGAGG + Intergenic
944901768 2:204223201-204223223 CAGGGTGACCAACAGCAGAGAGG - Intergenic
944901792 2:204223360-204223382 CGGGACGACCGGCTGCAGAGAGG - Intergenic
945330099 2:208529701-208529723 CAGGATGACTAGCTTCAAAGAGG - Intronic
946197404 2:218043323-218043345 CTGGATGACCAGCTGCAGAGAGG - Intronic
946197422 2:218043503-218043525 TGGGTTGACCAGCTGCAGAGAGG - Intronic
946789341 2:223284961-223284983 CCGGAGAACTAGCTGCAGAAAGG - Intergenic
947316708 2:228866622-228866644 CAGGACAACCAGCTGCAGAGAGG + Intronic
947316719 2:228866690-228866712 TGGGACAACCAGCTGCAGAGAGG + Intronic
948434558 2:237944271-237944293 CAGGACTACCAGCTGCAGGAAGG + Intergenic
948575364 2:238946468-238946490 CAGGATAACCAGCTGCAGAGAGG - Intergenic
948713038 2:239837005-239837027 ATGGATGACCAGCTGCAGAGAGG + Intergenic
1169165858 20:3423464-3423486 TAGGAAAACGAGCAGCAGAGTGG - Intergenic
1169197008 20:3688759-3688781 CAGGTGAATCAGCTGCAGAAGGG + Intronic
1170043819 20:12065257-12065279 CGAGACAACCAGCTGCAGACAGG - Intergenic
1170327880 20:15176499-15176521 CAGGACTACCAGCTGCAGGAAGG + Intronic
1170495046 20:16915732-16915754 CTGGACAACCAGCTACAGAGAGG + Intergenic
1170792966 20:19522726-19522748 CAGCAACACCAGTTGCAGAGAGG - Intronic
1170815012 20:19706470-19706492 CAGGACAAGCAGGTGGAGAGAGG + Intronic
1171236875 20:23534690-23534712 CCAGATGACCAGCTGCAGAGAGG - Intergenic
1172167636 20:32908611-32908633 CAGCAGCAGCAGCTGCAGAGAGG - Intronic
1172676723 20:36677532-36677554 CTGGACAACCAGCTGCAGAGAGG + Intronic
1172770879 20:37381958-37381980 CAGGCTACCCAGCTGCACAATGG - Intronic
1173207578 20:41006977-41006999 TGGGACAACCAGCTGCAGAAAGG - Intergenic
1173418631 20:42880683-42880705 CAGGATAGACAGCTAGAGAGAGG + Intronic
1173524435 20:43721289-43721311 AGGGATGACCAGCTGCAGAGAGG - Intergenic
1173777787 20:45725341-45725363 CAGGAGAACTGGCTGGAGAGTGG + Intronic
1173884535 20:46445804-46445826 TAGGATGACCAACAGCAGAGAGG - Intergenic
1174065907 20:47866032-47866054 CAGCATGACCAGATGCAGAGAGG + Intergenic
1175001326 20:55633240-55633262 CAGGGTGACCAGCTACAGAGAGG - Intergenic
1175064395 20:56272742-56272764 TTGGGTGACCAGCTGCAGAGAGG + Intergenic
1175065128 20:56277638-56277660 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1175065136 20:56277706-56277728 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1175675847 20:60945954-60945976 CAGGATGACCAGCAGCAGACAGG + Intergenic
1175959884 20:62630672-62630694 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1176373437 21:6075940-6075962 CAGGCCAGCCATCTGCAGAGTGG - Intergenic
1176408452 21:6434535-6434557 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1176790106 21:13310652-13310674 AGGGACAACCAGCGGCAGAGAGG - Intergenic
1176790113 21:13310710-13310732 GCAGATAACCAGCTGCAGAGAGG - Intergenic
1176976528 21:15327309-15327331 CAGGACAACAAGCTGCAGAGAGG + Intergenic
1176976543 21:15327434-15327456 TGGGATGATCAGCTGCAGAGAGG + Intergenic
1177357804 21:20031551-20031573 CGGGACAACCAGCTGCTGAGAGG - Intergenic
1177396061 21:20537922-20537944 CAGGTCTGCCAGCTGCAGAGAGG - Intergenic
1177396067 21:20537985-20538007 TGGGATGATCAGCTGCAGAGAGG - Intergenic
1177989287 21:28018850-28018872 TGGGACAACCAGCGGCAGAGAGG - Intergenic
1177989293 21:28018912-28018934 GCAGATAACCAGCTGCAGAGAGG - Intergenic
1178467051 21:32858568-32858590 CAGGATGACCAGCTGTAGAGAGG - Intergenic
1179221652 21:39413172-39413194 CAGGAGAACCAGCTCTAGAGAGG + Intronic
1179683945 21:43042861-43042883 TGGGACGACCAGCTGCAGAGAGG + Intergenic
1179720277 21:43312545-43312567 CAGGAAGCCCAGCTCCAGAGTGG - Intergenic
1179750040 21:43462303-43462325 CAGGCCAGCCATCTGCAGAGTGG + Intergenic
1180178906 21:46109212-46109234 CAGGACGACCAGCTGCAGAGAGG - Intronic
1182667625 22:31971011-31971033 CAGGATGACCAGCTGCACTGGGG - Intergenic
1183024943 22:35058057-35058079 TGGGACAACCAGCTGCAAAGAGG - Intergenic
1183533857 22:38383261-38383283 CAGGCTGACCACCTGCACAGTGG - Intronic
1184054239 22:42033759-42033781 TGGGACGACCAGCTGCAGAGAGG - Intronic
1184173893 22:42775139-42775161 CTGGATGACCAGCTGCAGAGAGG + Intergenic
1184176365 22:42791824-42791846 CAGGAACACCAGCTGGCGAGCGG - Intergenic
1184613632 22:45622671-45622693 CAGGATGACCAGTTACAGAGAGG + Intergenic
1184719151 22:46299439-46299461 CAGGGTATGCAGATGCAGAGGGG - Intronic
1184865801 22:47201383-47201405 CAAGACGACCAGCTGCAGAGAGG - Intergenic
1184869404 22:47225805-47225827 ATGGATGACCAGTTGCAGAGAGG - Intergenic
1184918104 22:47587104-47587126 CAGGACAGCCAGCAGGAGAGAGG - Intergenic
949218531 3:1600966-1600988 CGGGACAACCAGCTGCAGAATGG - Intergenic
949220700 3:1630348-1630370 CAGTATAACATGCTTCAGAGTGG - Intergenic
949680841 3:6512667-6512689 GAGGACAACCAGTTGCTGAGAGG + Intergenic
949949564 3:9217912-9217934 CAGGAGAGCCAGATGCAGTGGGG - Intronic
950207626 3:11092694-11092716 CAGTACAGCCAGCTGCAGAGAGG + Intergenic
950421574 3:12902736-12902758 CAGGACAGCCAGCTGGACAGAGG + Intronic
951136193 3:19107114-19107136 TGGGATGACCAGCTGCAGAGAGG - Intergenic
951136205 3:19107182-19107204 CAGGATGACCACCTGTAGAGAGG - Intergenic
951182250 3:19672142-19672164 GGGGACAACCAGCTGCAGAGAGG - Intergenic
951562431 3:23982063-23982085 AGGGATGACCAGCTGCAGAGAGG - Intergenic
951718440 3:25673727-25673749 TGGGATGACCAGCTGCAGAGAGG - Intergenic
952016154 3:28959286-28959308 CAGGATGTCCAACTGCAGAGAGG + Intergenic
952016162 3:28959340-28959362 TGGGAGGACCAGCTGCAGAGAGG + Intergenic
953530661 3:43737055-43737077 CAGGATAATCAGCTTCTCAGTGG + Intergenic
954035687 3:47849798-47849820 CCGGAGGAGCAGCTGCAGAGCGG - Intronic
954099334 3:48357515-48357537 CAGGATGACTAGCTGCAGATTGG - Intergenic
954099347 3:48357585-48357607 CAGGATTACCAGCTGCAGAGAGG - Intergenic
954099353 3:48357651-48357673 CAGGATGACCAGCTGCAGAGAGG - Intergenic
954225309 3:49177350-49177372 CAGTAAACCCAGCTGTAGAGAGG - Intergenic
954498065 3:50983484-50983506 TGGGATGACCAGTTGCAGAGAGG + Intronic
955241469 3:57182407-57182429 TGGGACAACCAGTTGCAGAGAGG - Intergenic
955241485 3:57182524-57182546 CAAGACAACCAGCAGCAGAGAGG - Intergenic
955241490 3:57182578-57182600 AGGAATGACCAGCTGCAGAGAGG - Intergenic
955920026 3:63945948-63945970 CAGAGTAACCAGATGCAGAGAGG + Intronic
956462275 3:69484690-69484712 CTGGACAACCAGCAGCAGAGAGG - Intronic
956989958 3:74751663-74751685 CAGGACAACCAGCCGTAGAGAGG - Intergenic
957625868 3:82651093-82651115 CGGGACTACCAGCTGCAGAAAGG + Intergenic
957678783 3:83404511-83404533 CAGGAGTACCAGCTGCAGAGAGG + Intergenic
957678787 3:83404565-83404587 CGGAACAACCAGTTGCAGAGAGG + Intergenic
957845142 3:85722068-85722090 CAGGAAGACGAGCTGCAGAAAGG - Intronic
957845152 3:85722136-85722158 CAGGATAACCAGCTGCAGAGAGG - Intronic
957845162 3:85722204-85722226 CAGGATAACCAGCTGCAGAGAGG - Intronic
957923099 3:86772345-86772367 CAGAACAACTAGCTGCAGAGAGG + Intergenic
958195337 3:90235868-90235890 CCAGACAACCAGCTGCAGAAAGG + Intergenic
958418749 3:93907260-93907282 CCAGACAACCAGCTGCAGAAAGG + Intronic
958418769 3:93907391-93907413 TGGGACAACCAGCTGCAGACAGG + Intronic
958636264 3:96750642-96750664 CAGGAGGACCAGCTGCAGAGAGG + Intergenic
958675552 3:97265007-97265029 CAGGATGACCAGCTGCAAAGAGG - Intronic
958675556 3:97265063-97265085 CAGGATGACCAGTTGCAGAGAGG - Intronic
958755912 3:98249021-98249043 CAGGATACCCAGTTAGAGAGTGG - Intergenic
959484310 3:106909175-106909197 CAGAGCTACCAGCTGCAGAGAGG + Intergenic
959863660 3:111242810-111242832 TAGGATGACCAGCAGCAGAGAGG - Intronic
960011122 3:112835439-112835461 TGGGCCAACCAGCTGCAGAGAGG - Intronic
960333882 3:116392840-116392862 CGGGATGACAAGCTACAGAGAGG + Intronic
960634213 3:119767972-119767994 CTGAATGACCAGTTGCAGAGAGG - Intergenic
960690624 3:120342406-120342428 TGGGGTGACCAGCTGCAGAGAGG + Intronic
961493608 3:127274625-127274647 CTGGACAACCAGCTGCAGAGAGG + Intergenic
961942942 3:130656443-130656465 CCAGTTGACCAGCTGCAGAGAGG - Intronic
962785907 3:138768302-138768324 CAGGACAACAGGCTGCAGACAGG - Intronic
962824500 3:139088269-139088291 TGGGATGACCAGCAGCAGAGAGG - Intronic
962824518 3:139088410-139088432 CAGGATGACCAGCTGCAGAGAGG - Intronic
963454229 3:145522950-145522972 CAGAATGACCAGTTGCAGAGAGG - Intergenic
963483378 3:145904447-145904469 CAGAATGACCGACTGCAGAGAGG + Intergenic
963483390 3:145904517-145904539 TGGGATAACCAGCTGTAGAGAGG + Intergenic
963805187 3:149714920-149714942 GGTGATGACCAGCTGCAGAGAGG + Intronic
963906071 3:150774530-150774552 CAGGACTACCAGCTGCGGAAAGG - Intergenic
964255018 3:154766335-154766357 TGGGATGACCAGCAGCAGAGGGG - Intergenic
964791779 3:160460030-160460052 TGGGACAACCAGTTGCAGAGAGG - Intronic
965541449 3:169875458-169875480 GGGAACAACCAGCTGCAGAGAGG + Intergenic
965793060 3:172410745-172410767 CTGGAAAACCAGCTGCAGAGAGG - Intergenic
966256159 3:177918255-177918277 CAGGATGACCAGCTGCAGAGAGG + Intergenic
966373169 3:179269570-179269592 CAGGAAAAGCATCTGCACAGAGG - Intergenic
966491518 3:180532310-180532332 CAGGACAACCAGCTGTAGAGAGG + Intergenic
966840179 3:184081713-184081735 CAGAATGACCGGCTGCAGAGAGG + Intergenic
966840189 3:184081781-184081803 CAGGACGACCAGCTGCATAGAGG + Intergenic
967326084 3:188241239-188241261 CAGGGCAAACAGCTGCAGAGAGG - Intronic
967444805 3:189554704-189554726 GAGGATGGCCAGCTGTAGAGAGG - Intergenic
968538649 4:1151022-1151044 CAGGGCAACCAGATGCAGAGAGG - Intergenic
968584941 4:1411944-1411966 CAGAGTAACCACCAGCAGAGAGG - Intergenic
968613112 4:1565993-1566015 CAGGAGCCCCACCTGCAGAGGGG + Intergenic
969194216 4:5547606-5547628 CAGGATGACCAGCTGCAGAGAGG + Intronic
970275092 4:14390865-14390887 CAGTGAAATCAGCTGCAGAGTGG + Intergenic
970959658 4:21857251-21857273 CATGACCACCAGCTGCAGAAAGG + Intronic
970959677 4:21857394-21857416 CAGGACCACCAGCTGTGGAGAGG + Intronic
971876810 4:32318717-32318739 CAGGAATACCAGCTGCAGAAAGG - Intergenic
971938779 4:33188547-33188569 TGGGATGACTAGCTGCAGAGAGG - Intergenic
972072596 4:35039181-35039203 CCGGACGACCAGCTGCAGAAAGG + Intergenic
972128700 4:35802290-35802312 TGGGAAAACCAGCTTCAGAGAGG + Intergenic
972158797 4:36198234-36198256 CAGGACGACCAGCTGCAGGGAGG - Intronic
972298635 4:37764447-37764469 TAGGAGTGCCAGCTGCAGAGGGG + Intergenic
972358235 4:38302972-38302994 TGGGGCAACCAGCTGCAGAGAGG - Intergenic
972358244 4:38303029-38303051 CAGGACAACCCGCTGCAGAGAGG - Intergenic
972930991 4:44071575-44071597 AAGGACAATCAGCTGCAGAGAGG - Intergenic
972931029 4:44071908-44071930 TGGGAAGACCAGCTGCAGAGAGG - Intergenic
973734440 4:53856674-53856696 GAGGCTAACCAGCTGGAGATGGG + Intronic
974278456 4:59758993-59759015 CAGAACTACCAGCTGCGGAGAGG - Intergenic
974972969 4:68853827-68853849 CAGGACAACCAGCTGCAGAGAGG - Intergenic
974972976 4:68853897-68853919 CGGGACAACAAGCTGCAGAGAGG - Intergenic
974972983 4:68853963-68853985 CAATATGACCAGCTGCAGAGAGG - Intergenic
975254329 4:72216111-72216133 CAAGATGACCAGCTGCAGGGAGG - Intergenic
975321365 4:73012334-73012356 AGGGATGACCAACTGCAGAGAGG + Intergenic
975597759 4:76066568-76066590 TGGGATGACCAGCAGCAGAGAGG - Intronic
975910299 4:79258876-79258898 CTGGATGACCAGCTGCAGAAAGG + Intronic
975910307 4:79258944-79258966 CAGGATGACCAGCTGCAGAGAGG + Intronic
976675455 4:87697704-87697726 AGGGACAATCAGCTGCAGAGAGG - Intergenic
976683639 4:87786234-87786256 CAGGAGAGCCAACTGCAGAGAGG + Intergenic
976734487 4:88296333-88296355 TAGGACGACCAGCTGCAGACAGG - Intergenic
976734495 4:88296401-88296423 CAGGACAACCAGCTGCAGAGAGG - Intergenic
976815814 4:89148062-89148084 TGGGACAACCAGCTGCAGAGAGG - Intergenic
977359125 4:95981316-95981338 ATGGATGACCAGCTGCAGAGAGG + Intergenic
977471882 4:97452626-97452648 CAAGATGACCAACAGCAGAGAGG + Intronic
977471891 4:97452706-97452728 CAGGACTACCAGCTGCAGAGAGG + Intronic
977487298 4:97665462-97665484 CAGGATGACCAGCTGCAGAGGGG - Intronic
977586867 4:98783808-98783830 CAGGACACACAGCAGCAGAGAGG + Intergenic
978229865 4:106385594-106385616 TGGGATAACCAGCTGCAGAGAGG - Intergenic
978249293 4:106610743-106610765 TGGGATGACCAGCTGCAGAGAGG + Intergenic
978484202 4:109231510-109231532 CAGGAAAGACAACTGCAGAGAGG + Intronic
978498497 4:109384772-109384794 TGGGATAGCCAGATGCAGAGAGG + Intergenic
978545972 4:109873095-109873117 CAGGTCAGCCAGGTGCAGAGTGG - Intergenic
978663402 4:111154468-111154490 CAAGACTACCAGCTGCAGAGAGG - Intergenic
979145397 4:117240119-117240141 CTGGAAGACCAGCTGCTGAGAGG + Intergenic
979145405 4:117240172-117240194 TGGGAGGACCAGCTGCAGAGAGG + Intergenic
979448179 4:120839492-120839514 TGGAATGACCAGCTGCAGAGAGG - Intronic
979648930 4:123107393-123107415 CAGGACTACTAGCTGCAGAAAGG - Intronic
979649463 4:123113993-123114015 CAGGATGACCAGCAGCAGAGAGG - Intronic
980007624 4:127559582-127559604 TGGGGTGACCAGCTGCAGAGAGG + Intergenic
980180260 4:129392913-129392935 CAGGACAACCAGCTGCAGAGAGG + Intergenic
980243227 4:130203234-130203256 CAGTGCAACCAGCTGCAGAGAGG + Intergenic
980306221 4:131064647-131064669 TAGGATGAACAGATGCAGAGAGG - Intergenic
980306239 4:131064787-131064809 TGGGATGATCAGCTGCAGAGAGG - Intergenic
980715174 4:136618086-136618108 CAGGATACCCAGTTAGAGAGTGG - Intergenic
980750050 4:137076888-137076910 TAGGCTGACCAGCTGAAGAGAGG - Intergenic
982151412 4:152462122-152462144 CAGACTACCCAGGTGCAGAGGGG - Intronic
982158026 4:152540422-152540444 ATGGATGACCAGCTGCAGAGAGG - Intergenic
982392279 4:154877615-154877637 CTGCAGAACCAGCTGCTGAGAGG + Intergenic
982802578 4:159722925-159722947 CAGGACTACCAGCTGCAGGAAGG - Intergenic
982959853 4:161823022-161823044 CAGGACAACCAGCTGTGGAAAGG - Intronic
983491929 4:168398795-168398817 CAGGATTACCAGCTACGGAGGGG + Intronic
983491940 4:168398865-168398887 CAGGGCAACCAACTGCAAAGAGG + Intronic
983651497 4:170040727-170040749 TGGGACCACCAGCTGCAGAGAGG + Intergenic
983784597 4:171715696-171715718 CGAGATGACCAGCTGCAGAGAGG + Intergenic
984325235 4:178242244-178242266 CAAGATGACCATTTGCAGAGAGG + Intergenic
984557696 4:181234934-181234956 AAGGATTGCAAGCTGCAGAGAGG - Intergenic
986215059 5:5712522-5712544 CAGGACAGTCAGCTGCAGAGAGG - Intergenic
986275567 5:6272217-6272239 CAGGATCACCAGCTGGGGAAGGG - Intergenic
986923550 5:12717588-12717610 TGGGACAGCCAGCTGCAGAGTGG + Intergenic
987274518 5:16347987-16348009 AAGGATCTCCAGCTGCAAAGAGG + Intergenic
987537735 5:19209208-19209230 CAGGACTACCAGCTGTAGAAAGG + Intergenic
987609312 5:20181366-20181388 CAGGATATCTTGCTGCAGAGAGG + Intronic
987798886 5:22667280-22667302 CGGGACAACCAGCTGCAGAGAGG - Intronic
987999627 5:25331340-25331362 TGGGATGACCAGCTGCAGAAAGG + Intergenic
988093185 5:26569010-26569032 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
988143056 5:27267418-27267440 CCAGGTCACCAGCTGCAGAGGGG - Intergenic
988519291 5:31931500-31931522 CAGGACACCCAGCTGCAGCTGGG + Intronic
989279136 5:39621603-39621625 AGGGATGACCAGCTGCAGAGAGG - Intergenic
989279149 5:39621717-39621739 TGGGATGGCCAGCTGCAGAGAGG - Intergenic
989520696 5:42396773-42396795 CGGGATGACCAGCTACAGAGAGG + Intergenic
989730426 5:44641610-44641632 CAGGAAGACCTGCTGCAGAAAGG - Intergenic
990023769 5:51160188-51160210 CAGGAGGACCAGCTAGAGAGAGG + Intergenic
990308212 5:54514549-54514571 CAGGACAGCCAACTGCAGAGAGG - Intergenic
990923450 5:60993702-60993724 CGGGGTGATCAGCTGCAGAGAGG - Intronic
990923459 5:60993770-60993792 CAGGACAACAAGCTGCAAAGAGG - Intronic
991107591 5:62861875-62861897 CAGGATGACCAGCTGCAGAGAGG - Intergenic
991107599 5:62861943-62861965 AGGGATGACCAGCTGCAGAGAGG - Intergenic
991359277 5:65803019-65803041 CAGGACAACCAGCTGCAGAGAGG - Intronic
992693081 5:79259102-79259124 TGGGACAACCAGCTTCAGAGAGG - Intronic
992748479 5:79841134-79841156 CAGGAAGACCAGTTGCATAGTGG + Intergenic
994449922 5:99929317-99929339 TGGGATGACCAGCCGCAGAGGGG - Intergenic
994641030 5:102410241-102410263 GGGGATGACCAGTTGCAGAGAGG - Intronic
994641037 5:102410295-102410317 AAGGATGACCAGCTACAGAGAGG - Intronic
994648305 5:102497463-102497485 CCAGATAGCCAGCTGCAGAGAGG - Intronic
994790791 5:104223817-104223839 TGGGATGACCAGCTGCAGAGAGG - Intergenic
995742446 5:115369012-115369034 GAGGATGACCAGCTGCAGAGAGG + Intergenic
995744932 5:115393464-115393486 CAGCACAACCAGTAGCAGAGAGG - Intergenic
995744941 5:115393532-115393554 CAGGACGACCAGCTGCAGATAGG - Intergenic
995744952 5:115393602-115393624 TGGGACCACCAGCTGCAGAGAGG - Intergenic
995744959 5:115393668-115393690 TGGAATTACCAGCTGCAGAGAGG - Intergenic
996923808 5:128799827-128799849 CAGGACAACCAGCTGCACAGAGG - Intronic
996923830 5:128799957-128799979 CCAGACAACCAGCCGCAGAGAGG - Intronic
997582402 5:135026195-135026217 CAGGCCAAACAGCTGCAGACGGG - Intergenic
998453004 5:142249344-142249366 CATGATAAACAGCTCCAGACTGG - Intergenic
998792307 5:145778243-145778265 TAGGATTATCAGCTGCAGAGGGG + Intronic
999799383 5:155019393-155019415 GGGGACAACCAGCTGCAGAGCGG - Intergenic
999859951 5:155634040-155634062 TGGGATGACCAGCCGCAGAGAGG + Intergenic
1000266881 5:159646638-159646660 CAGAATCACCAGCTGCATATGGG + Intergenic
1000420245 5:161030480-161030502 CATGATCACCTGCTGCAAAGTGG + Intergenic
1000426238 5:161093977-161093999 TGGGACTACCAGCTGCAGAGAGG + Intergenic
1002001849 5:176200481-176200503 TAGGAGAGCCAGCAGCAGAGAGG + Intergenic
1002204502 5:177553764-177553786 CAGGAGACACAGCTGCTGAGGGG + Intronic
1002252489 5:177938497-177938519 TAGGAGAGCCAGCAGCAGAGAGG - Intergenic
1002689074 5:181037709-181037731 TGGGATGGCCAGCTGCAGAGAGG + Intergenic
1002986265 6:2192205-2192227 TGGGATGACCAGCTGCAGAGAGG + Intronic
1003123183 6:3334826-3334848 AAGGATCAGCAGCTGCAGACTGG - Intronic
1003284262 6:4721131-4721153 CAGGATAACCATATGCAGGAAGG + Intronic
1003687859 6:8322637-8322659 CAGGATAGGGAGCTGGAGAGGGG + Intergenic
1004279870 6:14271473-14271495 CAGGAAGACCAGCTGCAGAGGGG - Intergenic
1004304515 6:14487803-14487825 CGGGACGACCAGCTGCAGAGAGG + Intergenic
1004304541 6:14487972-14487994 CAGGAAGACCAGCTACAGGGAGG + Intergenic
1004520875 6:16359432-16359454 CTGGATGACCAGTTGCAGAGAGG + Intronic
1005021433 6:21423172-21423194 AAGGATGACTAGCTGCAGAGAGG - Intergenic
1005043451 6:21620309-21620331 TAGGATGACCAGCTACAGAGAGG - Intergenic
1005775871 6:29130209-29130231 CAAGACAACCAGCTGCAGAGAGG + Intergenic
1005781962 6:29201731-29201753 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1006225923 6:32535869-32535891 CAGGACAATCAGCTGCAGAGAGG + Intergenic
1006333179 6:33406449-33406471 CATGATAACCAGCCCCAGCGTGG - Exonic
1006347990 6:33498415-33498437 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1006467079 6:34202378-34202400 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1006500968 6:34458490-34458512 CTCGATGACCAGCTGCAGAGAGG + Intergenic
1006867571 6:37221912-37221934 CAGGACTATCAGCTGCATAGAGG - Intronic
1006867585 6:37222032-37222054 TAGGACGACCAGCTGCAGAGAGG - Intronic
1007197527 6:40075513-40075535 CAGGAAGACCAACTGCAGATGGG + Intergenic
1007905237 6:45453249-45453271 AAGGAAAATCAGCTGGAGAGAGG + Intronic
1008188289 6:48422764-48422786 TGGGATGATCAGCTGCAGAGAGG - Intergenic
1009196751 6:60695573-60695595 CCTGATGACCAGCTGCAGAAAGG + Intergenic
1009610138 6:65930903-65930925 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1009846871 6:69145775-69145797 CAGGATGACCAGCTGCAGAGAGG - Intronic
1009846878 6:69145845-69145867 CGGGATGAACAGCTGCAGAGAGG - Intronic
1010884068 6:81215349-81215371 CGGGATGACCAGCTGCAGGGAGG + Intergenic
1011526563 6:88271825-88271847 AAGAAGAACCAGCTGAAGAGAGG + Intergenic
1011530133 6:88312477-88312499 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1012052248 6:94361191-94361213 CAGGATGACCAGCTGCAGACAGG - Intergenic
1012141847 6:95635336-95635358 CGGGTCAACCAGCAGCAGAGAGG + Intergenic
1012141987 6:95636276-95636298 CAGGTCAACCAGCTGCAGAGAGG - Intergenic
1012231141 6:96762449-96762471 CCAGATGACAAGCTGCAGAGAGG - Intergenic
1012752799 6:103184410-103184432 CAGGTAAATCAGCTGCTGAGAGG + Intergenic
1013078552 6:106792227-106792249 CTGGATAAACAGATGCACAGGGG + Intergenic
1013086330 6:106861080-106861102 CAGGATAAGCAGCTGCAGAGAGG - Intergenic
1013086340 6:106861148-106861170 CAGGTTGACCAGCTGCAGAAAGG - Intergenic
1013086350 6:106861216-106861238 CAGGATGACTAGCTGCAGAGAGG - Intergenic
1013302911 6:108820907-108820929 CAGGATTATCTGCTGGAGAGTGG - Intergenic
1013375554 6:109510298-109510320 CAGGATGACCAGCTGCAGAAAGG + Intronic
1013375564 6:109510374-109510396 CAGGACGACCAACTGCAGAGAGG + Intronic
1013375568 6:109510427-109510449 CAGAACAACCAGTTGCAGAGAGG + Intronic
1013375584 6:109510544-109510566 CAGGACAACCAGTAGCAGAGAGG + Intronic
1013693099 6:112668209-112668231 TAGGATGACCAGTTGCAGATAGG + Intergenic
1014145315 6:117990872-117990894 CAGCAGAACCAGCCGCAGACTGG - Intronic
1014289302 6:119539843-119539865 CAGGAGGACCAGTGGCAGAGAGG + Intergenic
1014289317 6:119539977-119539999 CTGGACTACCAACTGCAGAGAGG + Intergenic
1015143326 6:129959007-129959029 TGGGAGGACCAGCTGCAGAGAGG + Intergenic
1015143336 6:129959077-129959099 CAGAATGACCAGCTGCAGATGGG + Intergenic
1015289288 6:131520191-131520213 AAGGAGTACCTGCTGCAGAGTGG + Intergenic
1015549095 6:134393437-134393459 CAGGAGGGCCAGCTGCAAAGGGG + Intergenic
1015663766 6:135604051-135604073 TGGGACGACCAGCTGCAGAGAGG + Intergenic
1016502461 6:144736935-144736957 CAGGATGACCAGCAGCTGCGTGG - Intronic
1017420486 6:154267869-154267891 CCTGACAACCAGCTGCAGGGAGG - Intronic
1018064919 6:160118214-160118236 CAGGATGACCAGTTGCAGAGAGG - Intergenic
1018064942 6:160118381-160118403 TGGGACAACCAGCTGCAGAAAGG - Intergenic
1018659933 6:166076640-166076662 GGGAATGACCAGCTGCAGAGAGG - Intergenic
1018730563 6:166646840-166646862 CAGGAGAACTTGCTGGAGAGGGG - Intronic
1019296066 7:276131-276153 TGGAACAACCAGCTGCAGAGAGG - Intergenic
1019568023 7:1694276-1694298 CAGGAAAACCACCCGCAGGGAGG - Exonic
1019652100 7:2165521-2165543 CAGGACCACCCTCTGCAGAGCGG + Intronic
1019897904 7:3997595-3997617 CAGGAGGACCAGCTGTAAAGAGG - Intronic
1020812415 7:12863848-12863870 CAGGATAACCAGCAGCATAGAGG - Intergenic
1020812425 7:12863918-12863940 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1021097281 7:16548083-16548105 CAGGACGACCAGCTGCAGAGAGG + Intronic
1021222186 7:17986833-17986855 CATGATAACCAGTTGGAGATCGG - Intergenic
1021412226 7:20341663-20341685 CAGCATAGCCAGCTGGAGATTGG + Intronic
1021500746 7:21329872-21329894 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1021540358 7:21750711-21750733 CAGGATGACCAGCTCCAGTGAGG - Intronic
1021561366 7:21971899-21971921 TGGGATGACCAGCTACAGAGAGG - Intergenic
1022423406 7:30245787-30245809 CCAGACAACCAGCTGCAGAGAGG - Intergenic
1022896054 7:34751340-34751362 TAGGTGAAGCAGCTGCAGAGAGG + Intronic
1023699914 7:42882793-42882815 CAGGCATACCAGCTGCAGTGGGG + Intergenic
1023789159 7:43737931-43737953 TGGGAGGACCAGCTGCAGAGAGG + Intergenic
1023790406 7:43749467-43749489 CGGGACTACCAGCTGCAGAGAGG - Intergenic
1023790412 7:43749533-43749555 CAGGACGATCAGCTGCAGAGAGG - Intergenic
1024293830 7:47827266-47827288 CAGGAGGACCAGCGGCAGTGGGG + Intronic
1024857021 7:53794376-53794398 CAGGACTACCAACTGCAGAAAGG - Intergenic
1025004150 7:55342447-55342469 CAGGCCAAGCAGCTGGAGAGCGG - Intergenic
1026370149 7:69691070-69691092 CAGGACTACCAGCTGCAGGAAGG - Intronic
1026793776 7:73352537-73352559 CAGGATCAGCACCTGCAGAATGG - Intronic
1027128382 7:75573259-75573281 TAGGATAATCAGCTGCAGAGAGG + Intronic
1027779814 7:82507467-82507489 CAAGATGACCAGCAACAGAGAGG - Intergenic
1028233351 7:88330755-88330777 CAGGATGACCAGGTGCAGAGAGG + Intergenic
1028640807 7:93039994-93040016 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1028816858 7:95156755-95156777 CGAGACTACCAGCTGCAGAGTGG - Intronic
1029378202 7:100195071-100195093 CCGAATAACCACATGCAGAGGGG + Intronic
1029443850 7:100602350-100602372 CAGGATAATCAGCGCCAGATGGG - Exonic
1029782112 7:102744771-102744793 CAGGACAACCAGTAGTAGAGAGG + Intergenic
1029899336 7:104022619-104022641 CAGGATGACCAGCTGCAGGGAGG + Intergenic
1029973736 7:104814228-104814250 TGGGACAACCAGCTGCAGAGAGG - Intronic
1030514027 7:110519198-110519220 TCAGATGACCAGCTGCAGAGAGG - Intergenic
1030981082 7:116186163-116186185 CAGGATTACCAGCTGTGGAAAGG - Intergenic
1031008814 7:116502237-116502259 CAGAAGAGCCAGCTGGAGAGAGG - Intronic
1031243316 7:119273006-119273028 CAAATTGACCAGCTGCAGAGTGG - Intergenic
1031248651 7:119350739-119350761 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1031265327 7:119573084-119573106 TAGGACAAACAGCTGCAGAGAGG + Intergenic
1031522694 7:122785761-122785783 CAGGATAAAGAGCTCCAGAGGGG - Intronic
1031786608 7:126041069-126041091 CAGGACAACCAGCTGAAGAGAGG + Intergenic
1031786618 7:126041139-126041161 CAGGATGACCAGCTGTGGAGAGG + Intergenic
1031836486 7:126686043-126686065 CCAGATGACAAGCTGCAGAGAGG + Intronic
1032503288 7:132416198-132416220 CAGGATAACCAGCTGGAGGAAGG + Intronic
1032658296 7:133955353-133955375 CGGGACAACCAGCTGCAGAGAGG - Intronic
1032858580 7:135857820-135857842 ATGGATAGCCAGCTGCCGAGAGG - Intergenic
1033031128 7:137827928-137827950 GAAGATAACCAGGTGGAGAGAGG - Intronic
1034210377 7:149358015-149358037 CGGGACAACCAGCTGCAGAAGGG - Intergenic
1034406393 7:150905702-150905724 CAGGACGACCAGCTGCAGAGAGG - Intergenic
1034481238 7:151321511-151321533 CAGGACGACCAGCTGCAGAGAGG + Intergenic
1034481251 7:151321581-151321603 TGGGATGACCAGCTGCAAAGAGG + Intergenic
1034481262 7:151321651-151321673 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1035252366 7:157605727-157605749 GGGGATGACCAGCTGCAGAGAGG - Intronic
1035434513 7:158849646-158849668 CAGGACGACCAGCTGCAGAGCGG - Intergenic
1035451018 7:158976754-158976776 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1035927404 8:3743290-3743312 CAGGAAAGCCATCTCCAGAGAGG - Intronic
1036907655 8:12720546-12720568 CAGGACTACCAGCTGCAGGAAGG + Intergenic
1036915418 8:12799574-12799596 TGGGACAACCAGCCGCAGAGAGG - Intergenic
1037777863 8:21847650-21847672 CTGGAGGACCAGCTGCAGAGAGG - Intergenic
1037890055 8:22619318-22619340 CTGGATCTCCAGCTGCAGGGGGG - Exonic
1037903044 8:22699081-22699103 AGGGATAGCCAGGTGCAGAGTGG - Intergenic
1038149351 8:24928404-24928426 CAGGACAACCAGCTGCAAAGAGG + Intergenic
1038193796 8:25347738-25347760 AAGGACAAATAGCTGCAGAGTGG - Intronic
1039182293 8:34880328-34880350 TGGGTTGACCAGCTGCAGAGAGG - Intergenic
1039351703 8:36770603-36770625 CAGGACAACTGGATGCAGAGAGG + Intergenic
1040725612 8:50378780-50378802 CAGGATGACCAGCTGCAGAGAGG - Intronic
1041018994 8:53619105-53619127 CAGGATTACCAGCTGTGGTGGGG - Intergenic
1041078607 8:54191898-54191920 CAGGAGAGCCAACTGCAGATGGG + Intergenic
1041186957 8:55310983-55311005 AATAATAACCAGCTGCAGTGGGG - Intronic
1041727447 8:61031307-61031329 CAGGAAACCCACCTGCAGGGTGG + Intergenic
1041779668 8:61563874-61563896 CAGGGTTCCCAGATGCAGAGTGG - Intronic
1042004949 8:64169589-64169611 CAAGACGACCAGCTGCAGAGAGG + Intergenic
1042169484 8:65978011-65978033 CTGGGTCAGCAGCTGCAGAGGGG - Intergenic
1042196795 8:66238008-66238030 CAGGATGACCAGCTGCAGAAAGG - Intergenic
1042396090 8:68293040-68293062 CAGTAGAACCAGATGCAAAGAGG + Intergenic
1042687834 8:71461924-71461946 TGGGACAACCAGCTGCAGAGAGG - Intronic
1043087146 8:75849332-75849354 CAGGATGACCAGGTACAGAGAGG - Intergenic
1043388471 8:79769245-79769267 CAGGACTACAAGCTTCAGAGTGG - Intergenic
1043568073 8:81570591-81570613 CGGGACAACCAGCTGCAGAGAGG - Intergenic
1043712790 8:83443439-83443461 CACAATTATCAGCTGCAGAGTGG + Intergenic
1043745594 8:83869785-83869807 TGGGATGACCAGCTGCAGTGAGG + Intergenic
1043750298 8:83926263-83926285 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
1043758323 8:84031848-84031870 TGGGACAATCAGCTGCAGAGAGG + Intergenic
1044008660 8:86965953-86965975 CAGGAGGACCAGCTGCAGAGAGG - Intronic
1044524942 8:93241480-93241502 TGGGACAGCCAGCTGCAGAGAGG - Intergenic
1044774927 8:95678067-95678089 CAGGGCAACCAGCTGTGGAGAGG - Intergenic
1044962379 8:97543151-97543173 CAGGTGGACCAGCTGCAGAGAGG + Intergenic
1046395238 8:113632579-113632601 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1048339093 8:133525309-133525331 CAGGACTACCAGCTGCAGGAAGG - Intronic
1048421680 8:134283954-134283976 CAGAATGATCAACTGCAGAGAGG - Intergenic
1048720045 8:137312940-137312962 CAGGATACCGGGCTGTAGAGTGG + Intergenic
1049021784 8:139961960-139961982 TGGGACAACCAGCTGCAGAGAGG + Intronic
1049294569 8:141824887-141824909 CAGGATGGCCGGCCGCAGAGCGG - Intergenic
1049824024 8:144655335-144655357 CAGGACAACCAGCTGAAGAGAGG + Intergenic
1049824044 8:144655471-144655493 TGGGATGGCCAGCTGCAGAGAGG + Intergenic
1050130518 9:2407002-2407024 CAAGATGACCAACAGCAGAGAGG + Intergenic
1050130526 9:2407082-2407104 CGGGACTACCAGCTGCAGAAAGG + Intergenic
1050182366 9:2934605-2934627 CTGGATGAACAGCTGCAGAGAGG + Intergenic
1050483998 9:6114773-6114795 CAGGATGACTGGTTGCAGAGAGG + Intergenic
1050725522 9:8644141-8644163 TGGGATGACCAGCTGCAGAGAGG + Intronic
1052609854 9:30758637-30758659 CAGGATTAGCAGCTGCAAAAAGG - Intergenic
1052633528 9:31071519-31071541 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1052652358 9:31321212-31321234 CAGGATGACCAGTTGTAGAGAGG - Intergenic
1052654215 9:31334889-31334911 CAGGATGACTGGCTGCAGAAAGG - Intergenic
1052707600 9:32011336-32011358 CGGGATGACCAGCTGCAGACAGG + Intergenic
1053128206 9:35599652-35599674 CAGGACAATCAGCTGCAGAGAGG + Intergenic
1053128216 9:35599719-35599741 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1055230454 9:74057986-74058008 CAAGACAATCAGCTGCAGAGAGG + Intergenic
1055887126 9:81076639-81076661 CAGGCTGAACAGCTGCAGAAGGG - Intergenic
1056192002 9:84194233-84194255 CAGGACAACCAGTAGCAGGGAGG - Intergenic
1056192011 9:84194286-84194308 CAGGACCACCAGCTACAGAGAGG - Intergenic
1056879716 9:90379665-90379687 CAGGATGACATGCTGCAGGGGGG - Intergenic
1056986137 9:91364782-91364804 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1056986141 9:91364848-91364870 CAGAACTACCAGCTTCAGAGAGG + Intergenic
1056986154 9:91364918-91364940 TAGGACAACCAGCTGCAGAGAGG + Intergenic
1057048992 9:91907830-91907852 CAGGTTACCCAGCTGCAGCGTGG + Intronic
1057468583 9:95337892-95337914 TGGGACAACCAGCTGCAAAGAGG + Intergenic
1057468594 9:95337962-95337984 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1057510794 9:95678289-95678311 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
1057531222 9:95847928-95847950 CCGGAAGACCAGTTGCAGAGAGG + Intergenic
1058091957 9:100814630-100814652 CAGGACTACCAGCTGCAGAGAGG + Intergenic
1058091970 9:100814700-100814722 CAGGCTGATCAGCTACAGAGAGG + Intergenic
1058510804 9:105713948-105713970 GGGGATGACCAGCTGCAGGGAGG + Intronic
1058510819 9:105714052-105714074 GGGGATGACCAGCTGCAGAGAGG + Intronic
1058754308 9:108070409-108070431 CAGGTCTACCAGCTGCAGGGAGG - Intergenic
1059566359 9:115386073-115386095 GGAGATGACCAGCTGCAGAGAGG + Intronic
1061261845 9:129484479-129484501 GAGGAGAACCAGGTTCAGAGAGG - Intergenic
1061267387 9:129514644-129514666 CAGGAAGGCCAGCTGCAGAGAGG + Intergenic
1062184745 9:135211903-135211925 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1062184765 9:135212037-135212059 CAGGACGACCAGCTGCAGAGAGG + Intergenic
1186805870 X:13139600-13139622 CAGGATGACCAGCTGCATAGAGG + Intergenic
1188207808 X:27381057-27381079 CAGGACTACCAGCTGTGGAGAGG + Intergenic
1188756539 X:33969561-33969583 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1188845415 X:35065929-35065951 CAGTATAGACAGTTGCAGAGTGG + Intergenic
1188859849 X:35243966-35243988 CAGGACAACCAGCTGCAGAGAGG - Intergenic
1189083608 X:37997940-37997962 TGGGACCACCAGCTGCAGAGAGG + Intronic
1189360220 X:40344123-40344145 CAGGAGGATCAGCTGCAGAGAGG + Intergenic
1189856332 X:45228885-45228907 TGGGGCAACCAGCTGCAGAGAGG - Intergenic
1190369533 X:49727496-49727518 CAGGATGACCAGCTGCAAAGAGG + Intergenic
1190444835 X:50514461-50514483 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1190444843 X:50514513-50514535 TGGGATGACCAGATGCAGAGAGG - Intergenic
1190620653 X:52284354-52284376 CAGGATGACAAGCTGCAGAAAGG - Intergenic
1190620659 X:52284422-52284444 CAGGACGACCAGTTGCAGAGGGG - Intergenic
1190681771 X:52831837-52831859 TGGGACGACCAGCTGCAGAGAGG + Intergenic
1190998859 X:55637836-55637858 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1192265301 X:69533585-69533607 CAGGACTACCAGCTGCAGAGAGG - Intergenic
1192265307 X:69533651-69533673 CAGGATGACCAGCTGCAGTGAGG - Intergenic
1193108395 X:77704002-77704024 CGGGATAATCAGCTGCTGAGAGG - Intronic
1193108437 X:77704307-77704329 CAGGATGACCAGCTGCAGAGAGG - Intronic
1193467612 X:81867960-81867982 TAGGATGATCAGCAGCAGAGAGG - Intergenic
1193467632 X:81868141-81868163 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1193468717 X:81875277-81875299 CCAGATGACCAGCTGCAGAGAGG - Intergenic
1194205029 X:91002494-91002516 ACAGACAACCAGCTGCAGAGAGG - Intergenic
1194379386 X:93175347-93175369 CAGAAAATCCAGCTGCAGAGAGG + Intergenic
1195126531 X:101814008-101814030 CAGGATGACGAGCTGCAGAGAGG + Intergenic
1195126550 X:101814149-101814171 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1195178502 X:102333936-102333958 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1195179028 X:102339197-102339219 CAGGACAATCAGGTACAGAGAGG - Intergenic
1195179045 X:102339338-102339360 CAGGCTGAACAGCTGCAGAGAGG - Intergenic
1195180362 X:102353147-102353169 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1195454240 X:105050906-105050928 CTGGATGACCAGCTGCACAAAGG - Intronic
1196589500 X:117469642-117469664 TAGGATTACCACCTACAGAGGGG + Intergenic
1197134138 X:123041431-123041453 AAGGATCAGCAGTTGCAGAGGGG + Intergenic
1197378435 X:125710048-125710070 CAAGATGACCAGCTACAGAGAGG + Intergenic
1197421304 X:126238672-126238694 TAGAATGACCAGCTGCAGAGAGG + Intergenic
1197501217 X:127244325-127244347 CAGGATGATGAGCTGCAGAAAGG - Intergenic
1197609520 X:128623091-128623113 CTGGGTGGCCAGCTGCAGAGAGG - Intergenic
1197952100 X:131908425-131908447 CAGGACGACCAGCTACAGAGGGG + Intergenic
1198504665 X:137289670-137289692 CATGCTAACCAGCTGAAGGGTGG + Intergenic
1198699439 X:139381995-139382017 GGGGATGACCAGCTACAGAGAGG - Intergenic
1198699450 X:139382068-139382090 GGGGATGACCAGCTGTAGAGAGG - Intergenic
1199103826 X:143838132-143838154 CAGGACAACCACCTGCAGAGAGG + Intergenic
1199103855 X:143838268-143838290 CAGGACAACCAGCTTTAGAGTGG + Intergenic
1199265372 X:145821314-145821336 CAGGAGAAGCTCCTGCAGAGGGG - Exonic
1199359992 X:146906947-146906969 CAGGACTACCAGCTGCAGAGAGG - Intergenic
1199360001 X:146907027-146907049 CAGGATGACCAGCAGCAGAGAGG - Intergenic
1199614812 X:149647974-149647996 CGGGACAACCAGCTTCAGAGAGG + Intergenic
1199861081 X:151801074-151801096 GAGGATGACCAGCTGCAGAGAGG - Intergenic
1201935381 Y:19406314-19406336 CCACATGACCAGCTGCAGAGAGG - Intergenic
1201939760 Y:19447284-19447306 CAGGAAGAATAGCTGCAGAGTGG - Intergenic
1202593588 Y:26512746-26512768 CAGGCTGACCACCTGCACAGTGG + Intergenic