ID: 957846902

View in Genome Browser
Species Human (GRCh38)
Location 3:85748662-85748684
Sequence CATCCTAATCCCATTTAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 67}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957846894_957846902 1 Left 957846894 3:85748638-85748660 CCTCAGTCTTTCCACAGCTGCCC 0: 1
1: 0
2: 1
3: 34
4: 367
Right 957846902 3:85748662-85748684 CATCCTAATCCCATTTAGGGGGG 0: 1
1: 0
2: 1
3: 6
4: 67
957846892_957846902 13 Left 957846892 3:85748626-85748648 CCTGCCTGGTTTCCTCAGTCTTT 0: 1
1: 0
2: 3
3: 38
4: 399
Right 957846902 3:85748662-85748684 CATCCTAATCCCATTTAGGGGGG 0: 1
1: 0
2: 1
3: 6
4: 67
957846891_957846902 14 Left 957846891 3:85748625-85748647 CCCTGCCTGGTTTCCTCAGTCTT 0: 1
1: 0
2: 6
3: 50
4: 472
Right 957846902 3:85748662-85748684 CATCCTAATCCCATTTAGGGGGG 0: 1
1: 0
2: 1
3: 6
4: 67
957846895_957846902 -10 Left 957846895 3:85748649-85748671 CCACAGCTGCCCTCATCCTAATC 0: 1
1: 0
2: 4
3: 47
4: 430
Right 957846902 3:85748662-85748684 CATCCTAATCCCATTTAGGGGGG 0: 1
1: 0
2: 1
3: 6
4: 67
957846893_957846902 9 Left 957846893 3:85748630-85748652 CCTGGTTTCCTCAGTCTTTCCAC 0: 1
1: 0
2: 0
3: 31
4: 311
Right 957846902 3:85748662-85748684 CATCCTAATCCCATTTAGGGGGG 0: 1
1: 0
2: 1
3: 6
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957846902 Original CRISPR CATCCTAATCCCATTTAGGG GGG Intronic
907264321 1:53247473-53247495 CATGCTAATCACATTTAGAAAGG + Intronic
1064934631 10:20666093-20666115 CATCCAAATACCATCCAGGGAGG - Intergenic
1069411034 10:68153572-68153594 AATCCTTAACCCATTTATGGAGG - Intronic
1070353105 10:75612077-75612099 CATTCAAATGCCATTTAGTGTGG + Intronic
1072530109 10:96311002-96311024 TTTCTTAATCCCATTTAAGGTGG + Intronic
1073052153 10:100674399-100674421 CACACTAGTCCCATTTTGGGGGG - Intergenic
1075006094 10:118831187-118831209 CATTCTTATCCCCTTTAGAGAGG - Intergenic
1081960936 11:47136715-47136737 CATCCTCCTCCCAATTAGGCAGG + Intronic
1087761354 11:102107333-102107355 GTTCTTAATCCCATTTAGGAGGG + Intergenic
1090998815 11:131891141-131891163 CAAGCTAATCCCTTGTAGGGAGG + Intronic
1093892427 12:24538236-24538258 CATGCTAATCCCAGCTTGGGTGG + Intergenic
1108741904 13:53346922-53346944 CATCTTCATACTATTTAGGGAGG + Intergenic
1112092112 13:96092046-96092068 CATCCAAAAGCCACTTAGGGAGG - Intronic
1116644572 14:47510133-47510155 GATGCTAATCCCATTCAGGAGGG - Intronic
1119662205 14:76460148-76460170 CATCCATATCCCATGTGGGGAGG + Intronic
1122249166 14:100425955-100425977 TATGCAAATCCCATTTGGGGTGG - Intronic
1125987404 15:44067635-44067657 CATACTAATCCCATTCATGATGG + Intronic
1129130228 15:73487063-73487085 GACCCTAATCCCATTTATGAGGG + Intronic
1131373294 15:91902552-91902574 CCTCCTACTCCCATGTAGGTTGG - Intronic
1136281394 16:29213482-29213504 CAGCCTGCTCCCACTTAGGGTGG - Intergenic
1139614305 16:68079765-68079787 CTTCCTCATCCCACTTGGGGCGG + Intergenic
1143969988 17:10788522-10788544 CATCCTACTCCCCTTGAGGCTGG - Intergenic
1149124419 17:53210462-53210484 GACACTAATCCCATTTATGGGGG - Intergenic
1158068028 18:53437047-53437069 AAACCTAATCCCTGTTAGGGAGG - Intronic
1164500695 19:28817347-28817369 CATCCTTGTCCCTTTTAGAGAGG - Intergenic
1168504819 19:56924603-56924625 CCTCCTAAGCACATTTAGGTTGG + Intergenic
925838024 2:7964788-7964810 CATCCAAATCCCATCTACTGAGG + Intergenic
931937765 2:67217103-67217125 CATGCTTCTCCCATTGAGGGAGG - Intergenic
937634106 2:124136459-124136481 CAAACTGATCCCATTTAAGGTGG - Intronic
939523326 2:143260864-143260886 CATTCTACTCACATTTAGGAAGG + Intronic
940413425 2:153392871-153392893 GGCACTAATCCCATTTAGGGGGG - Intergenic
943425835 2:187732489-187732511 CATGCTAAGCCTATATAGGGTGG + Intergenic
943767207 2:191676153-191676175 CAACCTAATCCCTTTTCTGGGGG + Intergenic
944272445 2:197798388-197798410 CATCCTCATCCCATTTACAGTGG - Intergenic
946257139 2:218451407-218451429 CTTAGTTATCCCATTTAGGGTGG - Exonic
1169635783 20:7689973-7689995 GAACCTAATCCCATTCACGGAGG - Intergenic
1173293450 20:41734555-41734577 CATCCCTATCCCATTGAAGGTGG + Intergenic
1174468575 20:50737421-50737443 AATCCTAGTTCCATTTATGGGGG + Intronic
1179141635 21:38731096-38731118 GATGCTAATCCCATTTATGAGGG + Intergenic
1179894155 21:44352007-44352029 CATCCTCATCCCGTGCAGGGTGG + Intronic
951369464 3:21827600-21827622 CATCCTGATTTCATATAGGGAGG + Intronic
957293591 3:78308139-78308161 CATTCTATTCCCAGTTAGGGTGG + Intergenic
957846902 3:85748662-85748684 CATCCTAATCCCATTTAGGGGGG + Intronic
963081505 3:141399270-141399292 CCTCCCAACCCCATTTAGGTGGG + Intronic
964456412 3:156872152-156872174 CTTCCTAATTCAATTTTGGGAGG + Intronic
967426821 3:189337176-189337198 CATCTTCATCCCAGTTAGGGTGG - Intergenic
973300775 4:48581336-48581358 CATCCTTATCCCATGTAGGTAGG - Intronic
973615571 4:52674412-52674434 CATCCTATTTCCTTTTAGGATGG + Intergenic
974866407 4:67586505-67586527 CAGCCTGATCCCTTTTAAGGTGG + Intronic
977580650 4:98721326-98721348 CATTCTAATCCCATTTTGTCTGG - Intergenic
979925557 4:126558748-126558770 CATACTAATCCCATTTATGTGGG - Intergenic
994765364 5:103909315-103909337 TTTCCATATCCCATTTAGGGTGG - Intergenic
997657253 5:135564434-135564456 CATCCTATTCCAATTCAAGGAGG - Intergenic
1000416708 5:160991927-160991949 CTTACTCATCCCATCTAGGGGGG + Intergenic
1001303502 5:170554878-170554900 CATCCTGGCTCCATTTAGGGTGG + Intronic
1007376469 6:41460229-41460251 CTTCCTGTTCTCATTTAGGGTGG + Intergenic
1017847657 6:158273401-158273423 CATACTAAGCCCAGTGAGGGAGG - Intronic
1021954120 7:25806826-25806848 AATCCTAATCCTGTTTGGGGTGG - Intergenic
1023653697 7:42397908-42397930 CATCCAACTCCCATTTATGCAGG - Intergenic
1027832823 7:83201863-83201885 TATGCAAATCCCATTTATGGAGG - Intergenic
1036031264 8:4976652-4976674 CCTTCTCATCCTATTTAGGGTGG - Intronic
1037182861 8:16028177-16028199 TATCCTCCTCCCAGTTAGGGAGG - Intergenic
1043591423 8:81837624-81837646 GGTCCTAATCCTATTTATGGGGG + Intronic
1044682895 8:94799900-94799922 CATCATTAACCCATTTAGGCTGG + Intergenic
1046418669 8:113949083-113949105 GACACTAATCCCATTTAGGAGGG - Intergenic
1047422597 8:124719414-124719436 CCTCTGATTCCCATTTAGGGTGG - Intronic
1048734220 8:137480636-137480658 CATCCTAATCTGATTAAGTGAGG - Intergenic
1050322236 9:4464902-4464924 TATCTTAATACCATTTTGGGGGG - Intergenic
1051931258 9:22389174-22389196 AATCCTAACCCAATTTGGGGGGG - Intergenic
1060229044 9:121813674-121813696 AATCCTAGCCCCATTTAGGGAGG + Intergenic
1060327115 9:122628202-122628224 CATCATCATCACATTTAGGTTGG - Intergenic
1189114759 X:38331175-38331197 CATCCTGACCCCATGTAGAGGGG + Intronic
1195890714 X:109690742-109690764 CATCCTAAGACATTTTAGGGGGG + Intronic
1196407515 X:115380081-115380103 TATCCTAAACCCATTTAGGGAGG + Intergenic
1197931156 X:131697655-131697677 GATACTAATCCCATTCATGGGGG - Intergenic