ID: 957849179

View in Genome Browser
Species Human (GRCh38)
Location 3:85783369-85783391
Sequence CAAATAAGAAGCAGAAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 361}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957849179_957849183 18 Left 957849179 3:85783369-85783391 CCAACACTTCTGCTTCTTATTTG 0: 1
1: 1
2: 0
3: 20
4: 361
Right 957849183 3:85783410-85783432 GCTGTGGTAACATTTGCTCCTGG 0: 1
1: 0
2: 3
3: 7
4: 140
957849179_957849185 22 Left 957849179 3:85783369-85783391 CCAACACTTCTGCTTCTTATTTG 0: 1
1: 1
2: 0
3: 20
4: 361
Right 957849185 3:85783414-85783436 TGGTAACATTTGCTCCTGGGAGG 0: 1
1: 0
2: 1
3: 14
4: 129
957849179_957849181 2 Left 957849179 3:85783369-85783391 CCAACACTTCTGCTTCTTATTTG 0: 1
1: 1
2: 0
3: 20
4: 361
Right 957849181 3:85783394-85783416 ATATGTCCAAGTTTCTGCTGTGG 0: 1
1: 0
2: 0
3: 20
4: 264
957849179_957849184 19 Left 957849179 3:85783369-85783391 CCAACACTTCTGCTTCTTATTTG 0: 1
1: 1
2: 0
3: 20
4: 361
Right 957849184 3:85783411-85783433 CTGTGGTAACATTTGCTCCTGGG 0: 1
1: 0
2: 0
3: 12
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957849179 Original CRISPR CAAATAAGAAGCAGAAGTGT TGG (reversed) Intronic
905405260 1:37728222-37728244 CAAATAGGAAGCTGGAGGGTGGG + Intronic
906010029 1:42514397-42514419 TAAAAAAGAAGGATAAGTGTTGG - Intronic
906327719 1:44858323-44858345 CAGATGAGAAGCAGCAGTGATGG - Intronic
908112294 1:60909348-60909370 CAAAGAAGCAGCCGAAGTGGTGG - Intronic
908125876 1:61029830-61029852 AAAAGAAGAAGAAGAAGTATGGG + Intronic
908864235 1:68527954-68527976 CTCAAAAGAAGCAAAAGTGTGGG - Intergenic
908922906 1:69217636-69217658 CAAATAATATGCAGAGGTTTTGG + Intergenic
910008908 1:82436286-82436308 CTAATAAAAACCATAAGTGTTGG + Intergenic
910361790 1:86419799-86419821 AAAAGAGAAAGCAGAAGTGTAGG - Intergenic
911958331 1:104265714-104265736 CAAATAAACTGCAGAAGTCTGGG + Intergenic
912317454 1:108679122-108679144 GAAAAAAGTAGCAGAGGTGTAGG - Intergenic
915527584 1:156485504-156485526 AAAAGAAGAAGGAGAAGGGTAGG - Intronic
916398695 1:164421865-164421887 CAAACAAGAGGAAGAAGAGTTGG - Intergenic
917496635 1:175546403-175546425 CAAGCAAGAAGCAGAATTGCCGG + Intronic
918294453 1:183143026-183143048 CAAATCAGAAGGGAAAGTGTGGG - Exonic
918811655 1:189129566-189129588 AAAAAAAGTAGCAGTAGTGTAGG + Intergenic
919837919 1:201589212-201589234 CAAATAAGTTAGAGAAGTGTGGG - Intergenic
919912405 1:202119607-202119629 AAAATAAGAAGCAGAAGGTCAGG + Intergenic
920242846 1:204566169-204566191 AAAATATGGAGTAGAAGTGTAGG + Intergenic
921528812 1:216253633-216253655 AATGGAAGAAGCAGAAGTGTAGG - Intronic
921622303 1:217339072-217339094 AAAAGAATAAGCTGAAGTGTTGG - Intergenic
921838492 1:219802815-219802837 CACAAAAGAAGCAGAAATGGAGG - Intronic
922305219 1:224338554-224338576 CTAATCAGAAGCTGAAGTGAAGG - Intergenic
923055469 1:230423550-230423572 GAAAATAGATGCAGAAGTGTGGG - Intronic
923799775 1:237196612-237196634 CAAATGAGATCCATAAGTGTAGG - Intronic
924031878 1:239893955-239893977 CGAAGAAGAAGGAGAAGTGGAGG - Intronic
1066013955 10:31219303-31219325 GAAATAAGAAGCAGGAGGGAGGG + Intergenic
1066457769 10:35586569-35586591 CAGATCAGAAGCAGAACTGGTGG - Intergenic
1066587769 10:36956453-36956475 CAAACTAGAGGCAGAAATGTAGG + Intergenic
1066678916 10:37917335-37917357 CAAATCAGAGGCTGAAGTGATGG + Intergenic
1069025660 10:63538156-63538178 AAAATAAGAAGCAGAAGCTGTGG - Intronic
1070145141 10:73768377-73768399 CAAAAAAGAAGAAATAGTGTTGG + Intronic
1070337721 10:75469998-75470020 CATCCAAGAACCAGAAGTGTGGG - Intronic
1071838258 10:89441423-89441445 CAGATAATAAGCAGCAGGGTTGG + Intronic
1072216522 10:93291828-93291850 CAAATAAGAACAACAAGGGTGGG + Intergenic
1072345889 10:94505575-94505597 AAAATAAGAAGAAGAAGAATAGG + Intronic
1072668041 10:97408725-97408747 CAAAGAGGAAGCAGAGGTCTGGG + Intronic
1072975025 10:100049998-100050020 GAAATAAGAATGAGAAGTATGGG + Intronic
1073810470 10:107147148-107147170 CCAATAAGAAAAAGAATTGTAGG - Intronic
1074659075 10:115630348-115630370 AAAATAAAAAGTACAAGTGTTGG + Intronic
1075099676 10:119497284-119497306 CAAATGTGAGGCTGAAGTGTAGG - Intergenic
1076122016 10:127943982-127944004 CTAATTAGAAGCAATAGTGTTGG + Intronic
1076696806 10:132251094-132251116 CAGATAGGAGGCAGATGTGTGGG - Intronic
1078402349 11:11039304-11039326 TAAATAAGAAGCAGGAGATTTGG + Intergenic
1080091629 11:28355452-28355474 CAATGAAGAAACAGAGGTGTAGG - Intergenic
1081064971 11:38530695-38530717 AAAAGAAGAAGAAGAAGTGAGGG - Intergenic
1081171329 11:39873327-39873349 CCAATAATTAGCAGAAGTGCAGG - Intergenic
1081358884 11:42147253-42147275 CATATGAGAAGCTGAAGGGTGGG - Intergenic
1082081562 11:48016209-48016231 CAAGCAAGAAGCAGAGGTATGGG - Intronic
1083653021 11:64214645-64214667 AAAATAAGAAAGAAAAGTGTAGG - Intronic
1084870143 11:72093179-72093201 AAACTAAGAACCAGAATTGTTGG - Intronic
1085079542 11:73622777-73622799 AAAAAAAGAAGGAGAAGTTTGGG + Intergenic
1085235736 11:75013881-75013903 CAAAGAAGAGGCAGAACTGAGGG + Intronic
1085840160 11:80002347-80002369 AAAAAAAGAAGAAGAAGTGTAGG - Intergenic
1085900323 11:80691500-80691522 CAAACTAGAGGCAGAAATGTAGG - Intergenic
1087775640 11:102254207-102254229 CAAATAAGGAGTAGTAGTTTTGG - Intergenic
1088267244 11:107999801-107999823 GAAACAAGTATCAGAAGTGTTGG + Intergenic
1090306384 11:125694666-125694688 CATAAATGAAGCAGAAATGTGGG + Intergenic
1090557302 11:127890362-127890384 CAAATTAGAAGCAGCAAAGTAGG - Intergenic
1093853411 12:24068821-24068843 CAAAAAAGATGCAGAAGGGCTGG + Intergenic
1096857964 12:54498889-54498911 AAAATAAAAAGCATAAGAGTAGG - Intronic
1097226677 12:57480754-57480776 TAAGGCAGAAGCAGAAGTGTGGG - Intronic
1097448803 12:59711006-59711028 GAAATATGAGGCTGAAGTGTTGG - Intronic
1098240966 12:68466721-68466743 AATATCAGAAGCTGAAGTGTTGG + Intergenic
1099415316 12:82377988-82378010 TAGAGAAGAAGCACAAGTGTCGG - Intronic
1099671062 12:85693363-85693385 CACATAAGAGGAAGAAGGGTTGG - Intergenic
1101511464 12:105396749-105396771 CTAATAAGAGGCAGAATTTTTGG + Intergenic
1101985544 12:109443723-109443745 CAAATGGGAAACACAAGTGTAGG + Intronic
1102019689 12:109673660-109673682 AAATGAAGAAGCAGAAATGTTGG - Intergenic
1102159163 12:110754736-110754758 CAAAGAAGAAGAAGAAGAGGAGG - Intergenic
1102911133 12:116714960-116714982 CAAATAAGATGCAGAACTGGGGG + Exonic
1103034147 12:117642732-117642754 CAAATAGGAATTAGAAGTTTGGG + Intronic
1103338216 12:120206086-120206108 CCAATAAAAAGCAGAAATATGGG - Intergenic
1104070444 12:125340455-125340477 CAGAAAGCAAGCAGAAGTGTAGG + Intronic
1105577199 13:21664925-21664947 CAGAGCAGAAGCAGAAGAGTAGG - Intergenic
1105721760 13:23123666-23123688 AAGATTAGAAACAGAAGTGTAGG - Intergenic
1106747280 13:32718661-32718683 AAAATAAGAAATACAAGTGTGGG + Intronic
1107002594 13:35566957-35566979 CAACTATGAATCAGAAGAGTTGG + Exonic
1108792560 13:53989449-53989471 CAAATAAAAAACAGAATTTTTGG + Intergenic
1110483045 13:76005510-76005532 CAAACAAGATGCTGAAGTGTAGG + Intergenic
1111386327 13:87533469-87533491 CAAAACAGAAGCAAAAATGTAGG - Intergenic
1111469924 13:88666892-88666914 CTATCAGGAAGCAGAAGTGTTGG - Intergenic
1112014136 13:95317380-95317402 CAAAGAAGAACCAGGAGTATGGG - Intergenic
1112362012 13:98727001-98727023 CAGATAAGAAGCATGAGTCTGGG - Intronic
1112460522 13:99600008-99600030 GAATTAAGAATCAGCAGTGTGGG + Intergenic
1112952638 13:105019844-105019866 TACTTAAGAATCAGAAGTGTGGG + Intergenic
1113963866 13:114140764-114140786 CAGAAGAGAAGCCGAAGTGTGGG + Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1115106025 14:29763065-29763087 TAAATAAGAAGCACAGGAGTTGG + Intronic
1115881655 14:37926082-37926104 AAGATCAGAAGCAGATGTGTTGG - Intronic
1118059920 14:62124803-62124825 CAAATAAGAAGCAGCAGAGCTGG + Intergenic
1118395669 14:65334428-65334450 GAAATGAAAAGCAGATGTGTTGG - Intergenic
1118467784 14:66046436-66046458 CAAGTTACAAGCAAAAGTGTAGG - Intergenic
1119191603 14:72686431-72686453 CAACTAAGAAGCAGAAGTGTAGG + Intronic
1119916022 14:78403007-78403029 CAAACAAGAAGCAGAAATCCGGG - Intronic
1119947569 14:78711011-78711033 AAAAGAAGAAGAAGAAGTATGGG - Intronic
1120928321 14:89820688-89820710 CAAATAAGAGGCTGCAGTTTGGG - Intronic
1121033384 14:90678729-90678751 CAATTAAGAAGCAGGAGAGTTGG + Intronic
1121311728 14:92939029-92939051 CAACTCAGAAGCAGAAGCTTAGG + Exonic
1123664002 15:22592538-22592560 CAAAAAAGAAGACTAAGTGTTGG - Intergenic
1123921940 15:25076359-25076381 CAAAAATGAGGCAAAAGTGTAGG - Intergenic
1125625241 15:41103289-41103311 CAATTAGGAAGCAGTAGTCTAGG - Intronic
1125664593 15:41420220-41420242 CAAATAAGAAGCTGAAGGGGAGG - Intronic
1126618352 15:50610528-50610550 AAAATAAGGTGCAGAAATGTAGG - Intronic
1128709060 15:69858370-69858392 CCAGTGAGAAGCAGGAGTGTAGG - Intergenic
1130517318 15:84636054-84636076 AAAAAAAGTAGCAGCAGTGTGGG + Intergenic
1131017794 15:89072173-89072195 CAAATAAGAAACAAATGTTTGGG + Intergenic
1131056123 15:89376183-89376205 GAAATAAAAAGCAAAAGTGAAGG - Intergenic
1133599785 16:7327983-7328005 GAAGGAAGAAACAGAAGTGTTGG - Intronic
1134560956 16:15209021-15209043 CAAATAAGAACAAAAAGGGTCGG - Intergenic
1134921493 16:18120641-18120663 CAAATAAGAACAAAAAGGGTCGG - Intergenic
1136177736 16:28529774-28529796 AAAAAAAGAAGAAGAAGGGTAGG - Intergenic
1137612740 16:49829775-49829797 CAAAGAACAAGAAGAAATGTGGG + Intronic
1138185911 16:54977451-54977473 TAAAAGAGAAGCAGAAGTGGGGG + Intergenic
1138704870 16:58904951-58904973 TAAATAAAAAGGAGAATTGTAGG + Intergenic
1139090319 16:63638399-63638421 CAAATAAGATGTAGATCTGTTGG + Intergenic
1139827521 16:69768936-69768958 CAAGAAAGAAGCATTAGTGTTGG + Intronic
1140536672 16:75715996-75716018 CATATAAGAAACAGAAATGTGGG - Intronic
1141188273 16:81804539-81804561 CACAAAAAAAGCAGAAGTGATGG - Intronic
1142048198 16:87939763-87939785 CCAATCAGAGGCAGAAGTGGAGG + Intergenic
1144113832 17:12066523-12066545 CAAAGAAGAAGAAGAAGAGGAGG - Intronic
1145807944 17:27747848-27747870 CAAACAAGAAGCATAGGTCTTGG - Intergenic
1147280665 17:39358079-39358101 TAACTAAGAACCAGAAGTGGAGG + Intronic
1148596062 17:48856571-48856593 CAAACCAGGAGCAGAAGTGGTGG + Intronic
1148822635 17:50368454-50368476 CAATAAAGAAGCAGAAGGTTTGG - Intronic
1149669936 17:58398390-58398412 CAAAAAAGAAGCAGATGTAATGG - Intronic
1149687928 17:58548951-58548973 AAAAAAAGAAGAAGAAATGTAGG + Intergenic
1149835804 17:59911263-59911285 CAAGTAAAAAGCATTAGTGTAGG + Intronic
1152056196 17:78029020-78029042 TAAAAAAGGAGCAGAAGAGTTGG - Intronic
1152333846 17:79688950-79688972 CAAAAAAAAAAAAGAAGTGTAGG + Intergenic
1152379951 17:79937224-79937246 CAAACAAGAAGCAGACGAGGGGG + Exonic
1152694550 17:81737513-81737535 AAAAAAAGAAGAAGAAGAGTGGG - Intergenic
1152814448 17:82399124-82399146 AAAATAAGAAGCACAGATGTTGG - Intronic
1153530883 18:6044525-6044547 TGAATAAGAAGTAGAGGTGTTGG + Intronic
1154452104 18:14486842-14486864 CAAGGAAGAAGCAGAAGGATAGG - Intergenic
1156048320 18:32902221-32902243 CAAATAAGTAATAGAAATGTGGG + Intergenic
1156065834 18:33141423-33141445 CAGATCAGAAGCAGAAGAGCTGG + Intronic
1156093891 18:33505956-33505978 CAAATAAGAAGTAAAGGTGAAGG + Intergenic
1156678007 18:39554291-39554313 CAAAAAAAAAACAGAAGTGAGGG + Intergenic
1157103623 18:44752725-44752747 GAAATAAGATGGAGAAGTGGAGG + Intronic
1157267832 18:46244244-46244266 GCAAGAAGAAGCAGAAGTCTTGG + Intronic
1158667853 18:59449087-59449109 CAACTAAGAAACTGAAATGTGGG + Intronic
1159450332 18:68593357-68593379 TTAATAAAAAGCAGAAGTTTTGG + Intergenic
1159843204 18:73425393-73425415 GAATTAAGAAGGAGATGTGTTGG - Intergenic
1161319913 19:3636389-3636411 CACAGCAGAAGCGGAAGTGTGGG - Intronic
1162122753 19:8481909-8481931 GATATAAGAAGCAGCTGTGTGGG + Intronic
1162667396 19:12225500-12225522 CTAATAAGAGGCAGAGGTGCTGG + Intronic
1164196522 19:22969756-22969778 TAATTAAGAAGAAAAAGTGTTGG + Intergenic
1164687360 19:30176288-30176310 CAACTGAGAAGCAGAAATGGAGG - Intergenic
1165653766 19:37515132-37515154 GAAATAAGAAACAGAAGTATTGG + Intronic
1166308505 19:41949120-41949142 AAAAAAAGAAACAGAAGTGGGGG - Intergenic
1167823381 19:51950071-51950093 TAAATAAAAATCAGAAGTGTGGG - Intergenic
1168633481 19:57975527-57975549 CCAGGAAGAAGCAGAAGTCTGGG + Intergenic
928122493 2:28593073-28593095 CAAAGAAGAAACAGATGTGAGGG - Intronic
928793771 2:34991749-34991771 CAAGGAATAAGCAGAAGTGCTGG + Intergenic
928994676 2:37275062-37275084 CAAGTAAGAAGCAGAAATAATGG + Intronic
929045129 2:37781796-37781818 CAAATAAGAAGAGGCAGTGCAGG - Intergenic
929103482 2:38340392-38340414 CAAATAAGAATTAGAAGTGGGGG + Intronic
929565480 2:42981324-42981346 CAAATGAGAAACAGGGGTGTAGG - Intergenic
929855559 2:45635929-45635951 AAAAGAAGAAGAAGAAGGGTGGG + Intergenic
930775183 2:55163904-55163926 CAAAAGAGAAGGAGAAGTTTTGG - Intergenic
934039241 2:88114430-88114452 AAAATAATAAGAAGAAATGTTGG - Intergenic
935668214 2:105532653-105532675 AAAATAAGAAAGATAAGTGTTGG + Intergenic
935946089 2:108288027-108288049 CAAGGAGGAAGAAGAAGTGTCGG + Intergenic
936940663 2:117880950-117880972 AAAATATGAAAGAGAAGTGTTGG - Intergenic
937152294 2:119694434-119694456 CATATCTGAAGCAGAGGTGTGGG + Intergenic
939125490 2:138172803-138172825 CAAATTATAAGCATCAGTGTTGG + Intergenic
939601924 2:144203218-144203240 CATATGAGAAACAGAAGAGTGGG + Intronic
939743553 2:145940201-145940223 CAAATAAGAAGGAGGAGGGAGGG - Intergenic
939784900 2:146497197-146497219 CAAAAAAGAAGAAAAAGTGTGGG - Intergenic
940851894 2:158695437-158695459 TAAAATAAAAGCAGAAGTGTTGG + Intergenic
941171326 2:162140845-162140867 AAAACAAGAAGAAGAAATGTAGG - Intergenic
942367340 2:175241348-175241370 AAAAAAAGAAGTAGAAGTGGGGG - Intergenic
942624463 2:177884598-177884620 TAAGTTAGAAGCAGAAGTGATGG + Intronic
943708351 2:191060312-191060334 GAAATAAGATGGAGAAGTGGTGG - Intronic
944059965 2:195562212-195562234 AAAAGCAGAAGCAGATGTGTGGG + Intergenic
944454272 2:199877147-199877169 CAAAGATGCAGCAGAAATGTGGG + Intergenic
945435021 2:209809126-209809148 CAAGGAAGAAGCTGAAGTGGAGG - Intronic
945663427 2:212713689-212713711 AAAATAAGTGGCAGAAGTGAAGG - Intergenic
945690339 2:213026170-213026192 CAAACAAAACTCAGAAGTGTAGG - Intronic
946901646 2:224378906-224378928 CAAATGAGAAGCAGATGAGCAGG + Exonic
947032564 2:225814102-225814124 CAAATATGAAGCACATGAGTTGG + Intergenic
947316760 2:228867047-228867069 AAAACAAGAAGGAGCAGTGTGGG - Intronic
947341118 2:229140753-229140775 CAAATATAAAGTAGAAATGTTGG - Intronic
1168882189 20:1216546-1216568 CAAAGAGGAACCAGGAGTGTGGG - Intergenic
1169106933 20:3004479-3004501 CAGTTAAGAAGCAGAAGATTTGG - Intronic
1169544126 20:6633574-6633596 CAAATAAAAAGAGGAAGGGTGGG - Intergenic
1170195472 20:13684870-13684892 CAAAGAAGCACCAGAAATGTGGG + Intergenic
1170822859 20:19768805-19768827 AAAATCAGCACCAGAAGTGTGGG - Intergenic
1171079442 20:22163301-22163323 CAAAGGGGAAGCAGAAGTGCCGG + Intergenic
1171335682 20:24383407-24383429 CAGTTAAGAGACAGAAGTGTTGG - Intergenic
1172439345 20:34954785-34954807 CAGAGAAGAAGCAGATTTGTGGG - Intronic
1172461243 20:35120562-35120584 GAAAAAAGAAGCAGAAGAGGAGG - Intronic
1172511213 20:35502307-35502329 AAAATAAGAAAGAGAAGGGTCGG + Intronic
1174680824 20:52406583-52406605 AAAAGAAGAAGAAGACGTGTGGG - Intergenic
1175526920 20:59640888-59640910 CAAAAATGAAGCAGTAGAGTAGG + Intronic
1176443919 21:6801458-6801480 CAAGGAAGAAGCAGAAGGATAGG + Intergenic
1176822086 21:13666497-13666519 CAAGGAAGAAGCAGAAGGATAGG + Intergenic
1177394962 21:20522024-20522046 CAAATAAGAAGCAGCAGCTCTGG - Intergenic
1177524479 21:22274019-22274041 AAAAAAAGAAGAAAAAGTGTAGG + Intergenic
1178116724 21:29425514-29425536 AAAAGAAGAAACAGAAGTGTGGG + Intronic
1178224654 21:30701084-30701106 CATATATTAAGCAAAAGTGTGGG - Intergenic
1178240841 21:30898737-30898759 AAAATATGAAGCAGAAGCATGGG - Intergenic
1180608707 22:17081730-17081752 CAAGTAGGAAACAAAAGTGTGGG - Intergenic
1180613666 22:17113779-17113801 CAAAGAAGAGGCAGCAGGGTTGG + Exonic
1180897274 22:19345840-19345862 AAAATGAGAAGCAGAAGGTTGGG - Intronic
1184826514 22:46956282-46956304 CTAATAAGAAGAAGAGATGTGGG + Intronic
951065538 3:18260891-18260913 CACATAAGAGGCAGAACTATTGG + Intronic
951093419 3:18601009-18601031 CAAGAAAGAGGTAGAAGTGTGGG - Intergenic
951626702 3:24672922-24672944 CAATTATGAAGGAGATGTGTTGG - Intergenic
952103725 3:30044915-30044937 CAAATATGAAGCAAAGGTTTAGG - Intergenic
952139490 3:30462348-30462370 CAGAGAAGAAGGAGAAATGTGGG + Intergenic
952402589 3:32976627-32976649 CAGAAAGGAAGCAGAAGAGTTGG - Intergenic
952519595 3:34143289-34143311 CAAACAAGAAGCAGAAAGTTAGG - Intergenic
952551616 3:34485086-34485108 CAAGGAAGAAGCAGAGATGTGGG + Intergenic
953752244 3:45617767-45617789 CAAGTCAGAAGCAGAAGGCTTGG - Intronic
954039110 3:47870876-47870898 CAGATCAGGAGCAGAAGTATTGG + Exonic
954840039 3:53503352-53503374 TAAAGAAAAAGCAGAAGTGGTGG + Intronic
956146973 3:66200035-66200057 AAAATAAGCAGCAAAAGTTTAGG - Intronic
956236899 3:67082593-67082615 CAAATAATATAGAGAAGTGTTGG - Intergenic
956739300 3:72262664-72262686 AAAATAAGAGGCACAAGTGAGGG + Intergenic
957830531 3:85511334-85511356 CAAATTACAAGCACAAGTATAGG - Intronic
957849179 3:85783369-85783391 CAAATAAGAAGCAGAAGTGTTGG - Intronic
958139598 3:89544419-89544441 TAGAAAAGAAACAGAAGTGTAGG + Intergenic
958459931 3:94381884-94381906 CACATGAGAATCAGAAGTCTAGG - Intergenic
958896708 3:99837668-99837690 CAGGTCAGAAGGAGAAGTGTTGG - Intronic
959687066 3:109159041-109159063 CAATTAAGAAGCAGCAGTGGAGG - Intergenic
961078053 3:124000120-124000142 CAAATATGAAGCTGAAATATAGG + Intergenic
961522298 3:127473730-127473752 GGAATAACAAGCAGGAGTGTGGG + Intergenic
961543821 3:127618340-127618362 CAAGTCAGAGGCAGAAGTGAGGG - Intronic
961995084 3:131233802-131233824 CAAAAAAGAAACAGCAGTGGAGG + Intronic
962250289 3:133832111-133832133 CAAAGAAAGAGCAGTAGTGTGGG - Intronic
962900651 3:139758685-139758707 CAAAAAAAAAGAAGAAGTGATGG + Intergenic
963255895 3:143144719-143144741 CAAAGTAGAAGCATATGTGTGGG - Intergenic
964436610 3:156659787-156659809 CAAATAAGAAACAGAGGAGTTGG - Intergenic
964735420 3:159912190-159912212 CAAACAACACGAAGAAGTGTGGG + Intergenic
965451956 3:168848921-168848943 CAAACAAGAAGGAGGAGAGTAGG - Intergenic
965845752 3:172959294-172959316 TAAAAAAGTGGCAGAAGTGTAGG + Intronic
965888189 3:173475511-173475533 CATATAAGATGCTGAAGTTTTGG - Intronic
966755699 3:183369317-183369339 CAAAAAAGGAGAAGCAGTGTTGG - Intronic
967761811 3:193234407-193234429 GAAATAGGAAGCAGTGGTGTTGG - Intergenic
971012844 4:22458180-22458202 CAAGTAGAAAGCAAAAGTGTAGG - Intronic
971127534 4:23770901-23770923 CAAGGAAGAAGCAGAAGTAGTGG - Intronic
971286805 4:25298011-25298033 CAAATTAGAACCACAAGTGATGG - Intergenic
972823993 4:42735427-42735449 CAAATAACATGCACAAGTGTAGG + Intergenic
973220450 4:47720617-47720639 CATACAAGAAGTAGATGTGTAGG - Intronic
973680676 4:53315688-53315710 CAATTATGAAGCATAAGTTTGGG - Intronic
974318267 4:60310142-60310164 CCAGTAAGAGGCAGAACTGTTGG - Intergenic
976280678 4:83324095-83324117 AAAAGAAGAAGAAGAAGTATTGG - Intronic
976774667 4:88694992-88695014 CAACTAAGAGGCATAAGTATTGG - Intronic
976815831 4:89148138-89148160 CTCAGAAGAGGCAGAAGTGTGGG + Intergenic
977441405 4:97072575-97072597 CAATTAAAATGCAGAAGAGTAGG - Intergenic
977501408 4:97843476-97843498 CACATAAGGAGTAGCAGTGTTGG + Intronic
979192781 4:117883711-117883733 CAAATAAGAAGAAAAAGTAACGG - Intergenic
980179999 4:129391722-129391744 GAAAGGGGAAGCAGAAGTGTAGG - Intergenic
980400932 4:132284872-132284894 CCAATTAGAGGCAGAAGTGAAGG - Intergenic
981227626 4:142315277-142315299 CCTATAAGAAGCATGAGTGTGGG - Intronic
981614205 4:146629610-146629632 TAACCAAGAGGCAGAAGTGTGGG - Intergenic
981664457 4:147207361-147207383 GAAATAAGAATCAGGAGTCTTGG + Intergenic
982494494 4:156073881-156073903 CCAATTAGAGGCAGAAGTGAAGG + Intergenic
982735392 4:159001155-159001177 CAATTAAGAAGACCAAGTGTTGG - Intronic
983565756 4:169149946-169149968 AGAATAAGAAGTAGAAGTGTAGG - Intronic
983839343 4:172437155-172437177 TAGATAAGAAGCATAAGTATAGG - Intronic
985015872 4:185635425-185635447 CACCACAGAAGCAGAAGTGTAGG + Intronic
986135524 5:4974150-4974172 AAAATAAGTAGGATAAGTGTAGG - Intergenic
986550633 5:8950640-8950662 GAAACAAAAAGTAGAAGTGTAGG - Intergenic
987214110 5:15714863-15714885 AAAAAAAGAGGCAGGAGTGTCGG + Intronic
987569445 5:19637411-19637433 GAAATAGGAATCAGTAGTGTAGG - Intronic
988712591 5:33793601-33793623 CAAATAAGAAAAAAAAGTTTGGG - Intronic
988817352 5:34847546-34847568 CACATCAGCAGCAGAAGTGCTGG + Intronic
988830882 5:34986252-34986274 CTAAAAAGAAGAAGAAGGGTGGG + Intergenic
989476045 5:41874082-41874104 GAAATATAAAGCAGACGTGTGGG - Intergenic
990088380 5:52007894-52007916 CATATAAGCAGCAAAACTGTTGG + Intergenic
990230027 5:53703184-53703206 CAAAAAATAAGCAGAACTGAAGG - Intergenic
990561769 5:56990652-56990674 GAAATAAGGTGCAGAAGTGCTGG - Intergenic
991698050 5:69291696-69291718 AAAAAATGAAGCAGAAGTTTAGG - Intronic
993130509 5:83892074-83892096 AAAAGAAGAAGCAGAGGTGAAGG - Intergenic
993142077 5:84046921-84046943 AAAGCAAGAAACAGAAGTGTAGG - Intronic
994021490 5:95030702-95030724 AAAATAAGAAGCAGATGAGAAGG + Intronic
994621902 5:102173422-102173444 CAGTGAAGAAGCAGAAATGTAGG + Intergenic
994632925 5:102308341-102308363 AAAAAAAGAAGGAAAAGTGTGGG - Intergenic
995274290 5:110260662-110260684 CATATCAGAAGCAGAGGTATTGG - Intergenic
995901550 5:117073646-117073668 CAAAGAATAATCAGAATTGTTGG - Intergenic
996532345 5:124539525-124539547 GAAATAAGAAACAGAAGTTGAGG + Intergenic
997888063 5:137649258-137649280 CAAATAAAAGACAGAAGTGATGG + Intronic
998634651 5:143940107-143940129 CAACCCAAAAGCAGAAGTGTTGG - Intergenic
998761279 5:145434720-145434742 CAAGGAAGATGCAGAAGTGGGGG + Intergenic
999285992 5:150394614-150394636 CAGATAAGCAGCAGAAAAGTGGG + Intronic
1001582608 5:172809074-172809096 AAAATGAGAACCAGAAATGTGGG + Intergenic
1003605043 6:7552132-7552154 AAAATAAAAAGCTTAAGTGTTGG - Intronic
1004286443 6:14325360-14325382 TAAAGAAGAAGCAGAACAGTTGG - Intergenic
1004968329 6:20879739-20879761 AGAATAGGAACCAGAAGTGTGGG - Intronic
1005348567 6:24912630-24912652 CAAATATGCAGTAGAAGTTTGGG + Intronic
1005576650 6:27196076-27196098 CATCTAAGAAGCAGACGTTTAGG - Intergenic
1006259974 6:32859539-32859561 AAAATAAGAAAGAGAAGTCTGGG - Exonic
1007109475 6:39304599-39304621 CAAAGAAGATGCAGAAGAGGCGG + Exonic
1007187774 6:39987030-39987052 CCAATATGCAGCAGAAGTGATGG + Intergenic
1007994908 6:46296681-46296703 CAAATAAGAAGCTAAATGGTGGG - Intronic
1008178319 6:48295386-48295408 CAAATATGTAGAAGTAGTGTAGG + Intergenic
1009186183 6:60577227-60577249 GAAATAAGTAACAGAAGTTTTGG + Intergenic
1009297237 6:61967476-61967498 AAAATAAGAAGCAGCAGGGTGGG + Intronic
1009595901 6:65736082-65736104 CAAAGGAGAACCAGAAGGGTGGG + Intergenic
1009902028 6:69819649-69819671 CAAAGAAGAGGCTGAAGAGTGGG - Intergenic
1010769127 6:79808426-79808448 CCAATTAGTAGCAGAATTGTAGG - Intergenic
1011356592 6:86478147-86478169 CAAATAAAAATCAGAAAGGTTGG + Intergenic
1012086361 6:94830349-94830371 AAAATAAGATGCAGACATGTTGG + Intergenic
1012138353 6:95587845-95587867 AAAAAAAGAAACAGACGTGTGGG - Intronic
1012272809 6:97235891-97235913 TGAATATGAAGCAGATGTGTTGG + Intronic
1014535040 6:122604933-122604955 AAAGTAAGAAGCAGAAGGATGGG - Intronic
1014674926 6:124351915-124351937 AAAATAATAAGCAGTAGGGTCGG - Intronic
1016046115 6:139482355-139482377 AGAACAAGAAGCAGAAGTGGAGG - Intergenic
1016393519 6:143598564-143598586 GAAAGTAAAAGCAGAAGTGTGGG + Intronic
1016487577 6:144559091-144559113 AAAATAAGAAGAAGAATTGGAGG - Intronic
1019837479 7:3403232-3403254 CTCATAAGAAACAGAAGTATAGG - Intronic
1023218729 7:37896194-37896216 TAAATAATAAGCAGAAGCCTAGG + Intronic
1024116165 7:46195884-46195906 CAAATTAGAAGCTGAGGTCTAGG + Intergenic
1026655281 7:72251168-72251190 CACATCAGAAGCAGAATTGAAGG - Intronic
1029975773 7:104831819-104831841 CAAATAATAAGCAGTAGTGCAGG - Intronic
1030150738 7:106402478-106402500 AAATTAAAAAACAGAAGTGTAGG + Intergenic
1030251010 7:107444885-107444907 AAACTAATAAGCAGAAATGTAGG + Intronic
1030975886 7:116122694-116122716 CATATAAGAAGCAGAAGATGAGG + Intronic
1031310305 7:120188220-120188242 GTAAAAATAAGCAGAAGTGTTGG + Intergenic
1031619970 7:123924234-123924256 CCAATCAGAAGCTGAAGTGGAGG + Intergenic
1031635223 7:124094061-124094083 CAAAAAAGAAACAGAAATTTAGG - Intergenic
1031884536 7:127232163-127232185 CAAAGAAGAAACAGAACTGATGG - Intronic
1031935711 7:127733629-127733651 CAAATGAGAAGCAATAATGTTGG - Intronic
1033059792 7:138095262-138095284 GAAATATGGAGCAGAAATGTGGG + Intronic
1035996216 8:4550232-4550254 GAAATGAGAAGCAAAAGTGAAGG - Intronic
1037208269 8:16352632-16352654 CAAATAAAAGACAGAAGTGTTGG - Intronic
1038048175 8:23784823-23784845 CAAAGTAGAAGCAGAAGGGCAGG + Intergenic
1038098849 8:24349041-24349063 CACATCAGAAGCAGAATTCTAGG - Intronic
1038457235 8:27684388-27684410 CATATTAGAAACAGAAGTCTGGG + Intergenic
1038608451 8:29034954-29034976 GAAAAAAGAAGTAGAAGTCTAGG + Intronic
1039670051 8:39585509-39585531 GAAATAAGCAGCAGAAATGGGGG - Intronic
1039867670 8:41519544-41519566 GAAATAAGAACCAGAAGCCTTGG - Intergenic
1041811722 8:61918843-61918865 CAAATATAAAACAGAAATGTCGG - Intergenic
1042176881 8:66045989-66046011 AAAATAAGAACCAGGAGTTTGGG + Intronic
1043544846 8:81303424-81303446 CAAATAAGTAGCACAAGACTGGG - Intergenic
1043704092 8:83327328-83327350 CAAAGGAGGAGCAGAAGTATGGG - Intergenic
1043832614 8:85007781-85007803 AAAACAAAAAGCAGAAGTGGTGG - Intergenic
1045182386 8:99798413-99798435 TAAATCAGAGGCAGAAGTTTAGG + Intronic
1046517127 8:115277028-115277050 CATATAAGAAGAATAAGTCTGGG + Intergenic
1047226625 8:122960557-122960579 TAAATAAGAAGAAGAAGTAATGG + Intronic
1047436561 8:124839794-124839816 AAAAGAAGAAGAAGAAGTGCTGG + Intergenic
1047464475 8:125099229-125099251 TAAAGCAGAAGCAGAAGGGTGGG + Intronic
1048486702 8:134854986-134855008 TATTTAAGAAGCAAAAGTGTGGG - Intergenic
1049015336 8:139915877-139915899 AAAATAAGAAGCATACTTGTTGG + Intronic
1049163133 8:141110432-141110454 CAGAGGAGAAGCAGGAGTGTGGG - Intergenic
1050235784 9:3578045-3578067 CATATAAAAAGCAGTAGTTTTGG + Intergenic
1051860519 9:21620254-21620276 CAAAGCAGAAGGAGAAATGTGGG + Intergenic
1053151684 9:35747863-35747885 GAAGAAAGAAGCAGTAGTGTTGG + Intronic
1053534919 9:38915834-38915856 CAGATAAGAAGCATATGTGAAGG + Intergenic
1053609126 9:39693204-39693226 AAAATAATAATCAGAAGAGTAGG + Intergenic
1053866970 9:42449476-42449498 AAAATAATAATCAGAAGAGTAGG + Intergenic
1054089190 9:60778285-60778307 AAAATAATAATCAGAAGAGTAGG - Intergenic
1054207137 9:62140256-62140278 CAGATAAGAAGCATATGTGAAGG + Intergenic
1054244399 9:62649194-62649216 AAAATAATAATCAGAAGAGTAGG - Intergenic
1054558526 9:66683737-66683759 AAAATAATAATCAGAAGAGTAGG - Intergenic
1054631213 9:67448098-67448120 CAGATAAGAAGCATATGTGAAGG - Intergenic
1054963826 9:70999422-70999444 GAAATAATAAGCAGAATTGGTGG + Intronic
1055869521 9:80857460-80857482 CAATTAAGAAGTAGTAGTGAAGG + Intergenic
1058059705 9:100482159-100482181 AAAAGAAGAAGAAGAAGAGTCGG - Intronic
1058318700 9:103602092-103602114 AAAATGAAAAGCAGAAGTGTTGG - Intergenic
1058567845 9:106305860-106305882 AAAATAAGAAGCCTAAGTGATGG + Intergenic
1059929993 9:119250944-119250966 CAAAGAAGCAGCAGAACAGTGGG + Intronic
1061115751 9:128610537-128610559 CAACTAAAAGGCAGTAGTGTTGG - Intronic
1061547274 9:131311836-131311858 AAAAAAAGAAGAAGAAGAGTTGG + Intergenic
1203525281 Un_GL000213v1:83069-83091 CAAGGAAGAAGCAGAAGGATAGG - Intergenic
1185510564 X:661080-661102 CAGAAAAGAAGAAGAAATGTGGG - Intergenic
1186557252 X:10572927-10572949 CTAATAAGTAGCAGAACTGCAGG - Intronic
1188708352 X:33363244-33363266 AAAATAATAAGCAGAAGAGAGGG + Intergenic
1188859538 X:35240876-35240898 CAAATCCGAATCTGAAGTGTGGG + Intergenic
1192313047 X:70032272-70032294 AAAAAAAGAAGAAGAAGTGATGG + Intronic
1192527312 X:71858726-71858748 CAAATGAGAAGCAGAAATCAAGG - Intergenic
1195042742 X:101029102-101029124 CAAATAAGAGGAAGAATAGTAGG - Intronic
1195348914 X:103978726-103978748 CAAATAAGAAGTATCAATGTAGG + Intergenic
1195356290 X:104042822-104042844 CAAATAAGAAGTATCAATGTAGG + Intergenic
1195358529 X:104060113-104060135 CAAATAAGAAGTATCAATGTAGG - Intergenic
1195420576 X:104670735-104670757 CAGATAGGATGAAGAAGTGTGGG - Intronic
1196610353 X:117707421-117707443 CAAACAACAAGCAGAAGTTAAGG + Intergenic
1197873102 X:131078663-131078685 CAGACAAGAAGCAGATGGGTGGG - Intronic
1200846642 Y:7837444-7837466 CAAATAAAAATCAGAAAGGTTGG + Intergenic
1201317365 Y:12661049-12661071 AAGATAAGAAGTACAAGTGTTGG - Intergenic