ID: 957849449

View in Genome Browser
Species Human (GRCh38)
Location 3:85787799-85787821
Sequence CAGATCATGCAGGACTTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957849449_957849453 7 Left 957849449 3:85787799-85787821 CCTAACAAGTCCTGCATGATCTG 0: 1
1: 0
2: 4
3: 21
4: 222
Right 957849453 3:85787829-85787851 ACTTCTTTTCTGCCTCATCTTGG 0: 1
1: 0
2: 1
3: 53
4: 370
957849449_957849454 8 Left 957849449 3:85787799-85787821 CCTAACAAGTCCTGCATGATCTG 0: 1
1: 0
2: 4
3: 21
4: 222
Right 957849454 3:85787830-85787852 CTTCTTTTCTGCCTCATCTTGGG 0: 1
1: 0
2: 4
3: 53
4: 551

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957849449 Original CRISPR CAGATCATGCAGGACTTGTT AGG (reversed) Intronic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
905843310 1:41204438-41204460 CAGATCATGCAGGACTATGTGGG - Intronic
906337450 1:44946040-44946062 ACAATTATGCAGGACTTGTTTGG - Intronic
908724330 1:67158502-67158524 CAGATTATGCAGAAATTTTTAGG + Intronic
910035282 1:82781072-82781094 CAGATCATCTATGACATGTTTGG - Intergenic
910075640 1:83274955-83274977 CAGTTTTTGCAGGAGTTGTTGGG - Intergenic
910172007 1:84387642-84387664 GAGATCATGCAAGACATGTGCGG + Intronic
910733326 1:90422732-90422754 CATTTCTTGCAGGACTTGTCTGG - Intergenic
911291371 1:96060350-96060372 CAGATCATTCAGGAATTGTATGG + Intergenic
911474441 1:98358526-98358548 CGGAACATGCAGGATTTGTAGGG + Intergenic
913475646 1:119234753-119234775 CAGATCATGCTATTCTTGTTTGG - Intergenic
915100184 1:153493550-153493572 CAGAGCAAGCAGGACTTGACAGG - Intergenic
915251477 1:154592248-154592270 CAGCTCAGGCAGTACTTCTTGGG + Intronic
915900337 1:159842119-159842141 CAGATCATGCAGGGTCTGATAGG + Intronic
916333006 1:163639282-163639304 CAGACCATGGAGGATTTGTAGGG - Intergenic
916491270 1:165304459-165304481 AGGAGCATGCAGGACTGGTTTGG + Intronic
919300872 1:195763659-195763681 AAAATGATGCAGGACTTTTTGGG - Intergenic
922224082 1:223630198-223630220 CAGATCATGAATGACTTTGTTGG - Intronic
922248673 1:223826231-223826253 CAGATCATGCATGTCTTTATAGG + Intronic
922429080 1:225529220-225529242 CAGATCATGCAGGACCTTGCAGG - Intronic
922518978 1:226229875-226229897 CAGATCATGCATGGCTTTATAGG + Intergenic
922655450 1:227378527-227378549 AAGATCATGCAGCACTTTATAGG + Intergenic
923403237 1:233636139-233636161 CAGATCATGTAGGACCTTATGGG + Intronic
1063629723 10:7722495-7722517 CAGATCACGAAGGACGTGTATGG - Intronic
1064990717 10:21254633-21254655 CAGAACATGCACGTGTTGTTGGG + Intergenic
1065388918 10:25162134-25162156 CAAATCATGTAGGACTTTATGGG - Intergenic
1066125566 10:32338513-32338535 CAGATCAGGAAGGGATTGTTAGG - Intronic
1070005671 10:72421882-72421904 CAGAACATGCAAGACTTCATAGG - Intronic
1072269615 10:93763318-93763340 GAGATCCTGCAGAACTTGTTTGG - Intronic
1072690075 10:97566976-97566998 CAGATGCTGCAGGAATTTTTGGG + Intronic
1074145188 10:110711034-110711056 AAGACCATGGAGGACTTGTGGGG + Intronic
1074918554 10:117983181-117983203 CAGATCATGCAGGGCTCTCTAGG - Intergenic
1075203066 10:120422420-120422442 CGGATCATGCAGGCCATGTTGGG + Intergenic
1076297459 10:129397664-129397686 CGGATCCTGCAGGACTTTGTGGG - Intergenic
1077951631 11:6964660-6964682 CAGATCATGTAAGTCTTCTTAGG + Intronic
1078877132 11:15410206-15410228 CTGATAAGGCAGGAGTTGTTGGG + Intergenic
1079612129 11:22446158-22446180 CAGATTATGAAGGTTTTGTTAGG + Intergenic
1080504654 11:32900590-32900612 TAGATCATGCAGGGCTTTGTAGG - Intronic
1080767316 11:35308929-35308951 CAGCTCAGGCATGACTTGGTGGG - Intronic
1081925050 11:46819387-46819409 CAGATCATGCAGGACTATGAAGG + Intronic
1082812671 11:57487993-57488015 CAGAGCTTGCAGGGCTTTTTAGG + Intronic
1086885481 11:92200629-92200651 CAGATCATGCAGGACTGTTTGGG + Intergenic
1090137458 11:124212522-124212544 CAAATCATATAGTACTTGTTGGG + Intergenic
1091146315 11:133283262-133283284 CAGATCCTGCATGAATGGTTTGG + Intronic
1091182869 11:133622601-133622623 CAGATTATGAAGGACTTTATAGG - Intergenic
1091427790 12:406502-406524 CAGATCATACAGGACCTTGTCGG + Intronic
1091985417 12:4907318-4907340 CAGATCATGCAGGGCCTCTAAGG - Intergenic
1092737353 12:11595093-11595115 CCGATCATGCAGGACATTGTAGG - Intergenic
1096269718 12:50155382-50155404 CAGACCATGCAAGAAATGTTGGG - Intronic
1096966905 12:55635752-55635774 GAGATCCTGCAGGACGTGGTGGG - Intergenic
1097672490 12:62556759-62556781 CAGATCATGTAGAATGTGTTAGG + Intronic
1097838485 12:64297620-64297642 GAGAACATGCAGAACATGTTTGG + Intronic
1098315596 12:69189531-69189553 CAGATCATTCATGACATGCTTGG - Intergenic
1103449797 12:121020643-121020665 CAAGTCCTGCAGGACTGGTTGGG - Exonic
1107381390 13:39860411-39860433 CAGATGGGGCAGGACTTGTCCGG + Intergenic
1107821029 13:44285843-44285865 CAGTTCATGCAGGACCTGAGGGG - Intergenic
1108775123 13:53756728-53756750 GAGATCAAGCATGTCTTGTTTGG - Intergenic
1109064870 13:57674105-57674127 TAAATCATGCAACACTTGTTAGG - Intronic
1110064765 13:71089386-71089408 CAGATCATGTAGAACCTGGTGGG + Intergenic
1110138042 13:72092337-72092359 CAGATCATATAGGGCTTGATGGG - Intergenic
1111708939 13:91786341-91786363 CAAGTAATGCAGGACTTGTTAGG - Intronic
1113252471 13:108469415-108469437 CAGATCATTCATGAATGGTTTGG - Intergenic
1116175304 14:41462214-41462236 TAGATCATGTAAGAGTTGTTTGG - Intergenic
1117780567 14:59227444-59227466 AAGGTCCTGAAGGACTTGTTTGG + Intronic
1118221238 14:63856195-63856217 CAGATCATGCAGGGCCTTTCTGG + Intronic
1120000427 14:79296890-79296912 CAGATCACGCAGGAACTGCTAGG - Intronic
1121942365 14:98083302-98083324 CAGCTCATCCTGGATTTGTTGGG - Intergenic
1127888393 15:63224791-63224813 CAGATTATGGAGGACTTGGGAGG - Intronic
1128368595 15:67022866-67022888 TAGATCATGCAGGACTTCACAGG + Intergenic
1128446666 15:67768442-67768464 CAGAGCATGCAGCATTTGGTGGG - Intronic
1129624534 15:77182792-77182814 CAGATCATGCAAGGCCTTTTAGG + Intronic
1133629602 16:7607447-7607469 GAAATCATTCAGAACTTGTTAGG - Intronic
1134511879 16:14855035-14855057 CAGATTGTGCAGGGCTTGGTGGG + Intronic
1134662100 16:15991921-15991943 CAGTTCATGCATGCCCTGTTAGG + Intronic
1134699522 16:16253534-16253556 CAGATTGTGCAGGGCTTGGTGGG + Intronic
1134972307 16:18541137-18541159 CAGATTGTGCAGGGCTTGGTGGG - Intronic
1136028488 16:27485474-27485496 CAGATCATTCCGGACATGATGGG + Intronic
1137786346 16:51140569-51140591 CAGAGTAGGCAGGACTGGTTTGG + Exonic
1138044357 16:53705312-53705334 CAGATCATGCAGGATCTTGTAGG - Intronic
1150113839 17:62526967-62526989 CAGATCACGCAGGAGCTTTTAGG - Intronic
1150420521 17:65030357-65030379 CAGATCATGCAGAATTTGAAAGG + Intronic
1150499434 17:65636450-65636472 GAGATGATGCAGTACTTGCTAGG - Intronic
1151021962 17:70627459-70627481 TACATCCTGCAGGACATGTTAGG + Intergenic
1151312974 17:73305413-73305435 CAGATCTGCCAGGCCTTGTTTGG + Intronic
1153015487 18:579182-579204 GAGATGATGCAGGACATGTTGGG - Intergenic
1153161368 18:2207913-2207935 CAGATCATGCTGAGCTTCTTTGG - Intergenic
1153165857 18:2261588-2261610 CAGACCATACAGGACTTTGTGGG - Intergenic
1155460564 18:26077233-26077255 CAGATCAGGAAGAACATGTTTGG - Intronic
1156266451 18:35492675-35492697 CAGATAATGCTGGACTGATTTGG - Intronic
1156603818 18:38642064-38642086 CAAATCAAGCAGGGCTAGTTTGG + Intergenic
1158725507 18:59968250-59968272 CAGATCATGCAGGTTTTGCAAGG + Intergenic
1159862727 18:73668525-73668547 AAGATCATGCAGCATATGTTTGG + Intergenic
1161490374 19:4557913-4557935 CAGGTCGTGCAGGGCCTGTTGGG - Intronic
1161619195 19:5289533-5289555 CAGGTCGTGCAGGACCTGGTGGG - Intronic
1161657167 19:5523396-5523418 CAAATCATGCAGGCCTTTGTGGG - Intergenic
1162868775 19:13569793-13569815 CAGATCATGCAGGGCTGGATAGG - Intronic
1163095371 19:15053549-15053571 CAGAGCATCCAGGTCTTCTTCGG - Exonic
1163883349 19:19946015-19946037 CAGATTAGGGAGGTCTTGTTGGG - Intergenic
1165992296 19:39823517-39823539 CAGATCACGTAGGTCTTGTGAGG - Intergenic
1166563672 19:43750164-43750186 CAAATCATGTAGGACCTGGTAGG - Intronic
1167297230 19:48658469-48658491 TAGATCATGCAGGGCTTTGTGGG + Intergenic
926475693 2:13319410-13319432 CAGAACATGTAAGACTTCTTAGG + Intergenic
929982254 2:46692464-46692486 CAGATCATGCAGAACTTTGAAGG - Intergenic
931065191 2:58578264-58578286 CAGATCATGCTGGACCTTGTGGG + Intergenic
932435236 2:71699429-71699451 TAGAACAGGCAGGACTCGTTAGG + Intergenic
932682068 2:73834957-73834979 TGGATCATGCAGGACTTTATGGG + Intronic
932946573 2:76239698-76239720 CAGCTCAAGCAGTACTTGATGGG - Intergenic
935288437 2:101587879-101587901 CAGATTATGCAGAAGTTTTTAGG + Intergenic
937162402 2:119777054-119777076 CAGACCATGTAGGGCTTTTTTGG - Intronic
938409168 2:131049564-131049586 CTGCTCATGGAGGTCTTGTTTGG - Exonic
941188892 2:162351823-162351845 AAGTTCAGGCAAGACTTGTTTGG + Intronic
941741804 2:169043622-169043644 CAGATGATGAGGAACTTGTTGGG + Intergenic
943699887 2:190978412-190978434 GAGTTGATGCAGGACCTGTTGGG - Intronic
944325777 2:198401825-198401847 CAGATCATGCAGGACCTTGTAGG - Intronic
944555356 2:200882944-200882966 CAGGTACTGCAGGGCTTGTTAGG - Intronic
946801028 2:223416182-223416204 CAGATCATGGAGTACATGGTAGG + Intergenic
948086216 2:235250967-235250989 CAGAGCATGCAGGATTTTTAAGG + Intergenic
1169031959 20:2416541-2416563 CAGATTATGCAGAAATTTTTAGG + Intronic
1169783468 20:9333544-9333566 CAGATCGTTCAGGACCTTTTCGG + Intronic
1171138499 20:22720040-22720062 TATAACATGCAGAACTTGTTTGG - Intergenic
1171251725 20:23653932-23653954 CAGCTCAAGCAGGGCTTGGTGGG - Intergenic
1172518223 20:35550651-35550673 CATATCATGCAGGGCTTGCAGGG + Intronic
1172807105 20:37619913-37619935 CAGAACATGCAGGACCTCGTAGG + Intergenic
1173559552 20:43993150-43993172 CGGATCATGCAGGACTTTGCAGG + Intronic
1173587446 20:44193615-44193637 CAGATCATGGAGGGCCTGGTAGG - Intergenic
1174552776 20:51373733-51373755 GAGAACTTGCAGGCCTTGTTGGG - Intergenic
1178051639 21:28754017-28754039 AAGATCATTCAGTACGTGTTTGG + Intergenic
1178974644 21:37210357-37210379 CAGATTATGCAGGAGTTTCTAGG + Intergenic
1179156118 21:38852512-38852534 CAGAGCTGGCAGGACTTGCTAGG - Intergenic
1182341741 22:29628100-29628122 CAGATTATGCAGCACTTGCCAGG + Intronic
1182872229 22:33658089-33658111 CAAATTAGGCTGGACTTGTTCGG - Intronic
952145656 3:30529173-30529195 CAGATCATGTAGAACTTCTGAGG - Intergenic
953249503 3:41231448-41231470 CATAACATGCAGGACTTTCTAGG + Intronic
953368765 3:42369755-42369777 CAGATCATGCAGGGGTTGTGGGG - Intergenic
953484586 3:43283273-43283295 CAGATCAGGAAGGGCTTGGTAGG + Intergenic
953581495 3:44161162-44161184 CAGATCATGTAGGCCTTATAAGG - Intergenic
954154630 3:48678661-48678683 AAGTTCCTGCAGGACGTGTTTGG - Exonic
954828928 3:53401534-53401556 CAGGCCATCCAGGACTTCTTAGG + Intergenic
954939805 3:54361347-54361369 CAGATCATGCTGGCAATGTTAGG - Intronic
955132123 3:56180557-56180579 GAGATCATGCAGTATTTGTCTGG - Intronic
955896463 3:63705910-63705932 CAGATCATCCAAAACCTGTTAGG + Intergenic
957849449 3:85787799-85787821 CAGATCATGCAGGACTTGTTAGG - Intronic
958152224 3:89705086-89705108 ATGAACATGAAGGACTTGTTGGG - Intergenic
959208945 3:103351063-103351085 CAGATCATGTAGGATCTTTTAGG + Intergenic
959399637 3:105883914-105883936 CAGACCATGCAGGGCTTTGTAGG - Intergenic
959833913 3:110896302-110896324 CAGATCATCAAGGACCTGTAGGG - Intergenic
959966190 3:112358148-112358170 CATAACATGCAGTACGTGTTTGG + Intronic
960640348 3:119817174-119817196 CCCCTCATGCAGGAGTTGTTCGG + Exonic
966273936 3:178141952-178141974 CAGATCATGTAGGCCTTGTGAGG - Intergenic
968421943 4:492652-492674 CAGAACATTCATGACATGTTTGG + Intronic
969134904 4:5021594-5021616 CTAATGGTGCAGGACTTGTTTGG - Intergenic
969275184 4:6129943-6129965 CATATCAAGATGGACTTGTTAGG - Intronic
972710401 4:41589428-41589450 CAGGTTCTGCAGGACTTGTAAGG + Intronic
974948345 4:68556061-68556083 CAGATCATTCATGATATGTTTGG - Intronic
975854451 4:78608409-78608431 CAGATCATGCAGGACCTTTTTGG + Intronic
976683854 4:87788490-87788512 CAGATCATGAAGGGCTTTCTAGG + Intergenic
978112208 4:104976891-104976913 CAGATGATGCAGGAGTTGCCAGG - Intergenic
978304556 4:107311418-107311440 TATCTCATGCAGGACTTGCTTGG - Intergenic
978634660 4:110789937-110789959 CACATCATGCAGGAGGTTTTGGG + Intergenic
978905825 4:114004525-114004547 CAGATCTTGCAGGACCTAATAGG - Intergenic
980804589 4:137795329-137795351 CAGCTAATGCAGCACTTGCTGGG - Intergenic
981422639 4:144568883-144568905 CAGAACATTCAGGGCTTCTTAGG - Intergenic
983842379 4:172473111-172473133 CAAATGATGCAGAAGTTGTTAGG - Intronic
983855849 4:172643435-172643457 CAAATCATGCATTCCTTGTTTGG + Intronic
985759534 5:1738168-1738190 CAGAGCATGAAGGATTTTTTAGG - Intergenic
988653014 5:33174480-33174502 CAGATAATGGAGGGCTTGATGGG - Intergenic
988774001 5:34460106-34460128 CAGACCATTCATGACATGTTTGG + Intergenic
989624232 5:43414240-43414262 CTGAACAGGCAGGACTTGCTGGG + Intergenic
989807195 5:45624110-45624132 CAGATAATGCAGGACCTTATGGG + Intronic
990801046 5:59603653-59603675 GAGATCATGCAGGATTTATCTGG - Intronic
990887189 5:60607940-60607962 CAGATCATGCAGAACTTTGTAGG + Intronic
992716993 5:79520783-79520805 CAGATCATGCAGTACCTCTTAGG - Intergenic
993714298 5:91259736-91259758 CAGCTCATGCAGGGCTTTGTAGG - Intergenic
993946214 5:94119901-94119923 CAGATCATGCAGGACTTTATAGG - Intergenic
996257443 5:121422613-121422635 CAGAGCATGCAGGAACTTTTAGG + Intergenic
997745695 5:136298396-136298418 CAGGTCATGCAGCACTTTGTAGG + Intronic
998454056 5:142257036-142257058 CAGTTCATGCAGGACTGCTCAGG - Intergenic
998727767 5:145037654-145037676 CAAATCATATAGGACTTTTTAGG - Intergenic
1000541028 5:162540233-162540255 CAGATCATGAAGGACTTTATGGG + Intergenic
1003455600 6:6278791-6278813 CAGATCAAGCAGGGCTTTGTAGG + Intronic
1005088409 6:22031235-22031257 CAGATGAAGCAAGACTTGGTTGG - Intergenic
1006143099 6:31942849-31942871 CAGCTCATGTAGGTCTTGATTGG + Intronic
1008650729 6:53559233-53559255 CAGATCATTCATGACATGCTTGG - Intronic
1009581400 6:65538787-65538809 CAGATCATGTAGGGTTTGTAAGG - Intronic
1010769427 6:79811714-79811736 CAGATTATGCAGGAGTTATGTGG + Intergenic
1011801365 6:91019740-91019762 CAGGTCCTGCAGGACTTTGTGGG - Intergenic
1012188126 6:96247298-96247320 CAGATCATGTAGGACTTTGTAGG + Intergenic
1014805788 6:125827849-125827871 CAGATCATGCAGGGCCTTCTTGG + Intronic
1015780083 6:136856261-136856283 CATATCAGCCAGGACTTCTTTGG + Intronic
1016306550 6:142690457-142690479 GAGAACATGCAGCATTTGTTTGG + Intergenic
1016492007 6:144615898-144615920 CTGATCATGTAGGACCTGGTAGG - Intronic
1020030369 7:4928535-4928557 CAGCTCATGGAGCACTTATTAGG + Intronic
1021874190 7:25033098-25033120 CAGGTCATGCAGGGCCTGATGGG + Intergenic
1022606271 7:31817440-31817462 CAGATCATGCAGGGCTTTGGAGG + Intronic
1023268095 7:38429806-38429828 CAGATCATTCTGGATTTTTTTGG - Intronic
1023393398 7:39731568-39731590 CAGATCATGAAGGACTTGAATGG + Intergenic
1023768337 7:43532484-43532506 TAGATCATGCCGGACTTGGCAGG - Intronic
1027421908 7:78025059-78025081 CAGATCATGCAGGCTTTTTTAGG - Intronic
1030487526 7:110189091-110189113 CAGATCATGCAGGACTTTGTAGG + Intergenic
1030924302 7:115432298-115432320 CAGATTATGCTGCACTTATTTGG - Intergenic
1031180134 7:118403671-118403693 GAGATCATGCAGTATTTGCTTGG + Intergenic
1032043544 7:128582725-128582747 CAGATCACGCAGGAGCTTTTAGG - Intergenic
1032429178 7:131847058-131847080 CACATCATGCAGGACCTCTTTGG + Intergenic
1034258335 7:149736793-149736815 CAGATCAGCCAGGACCCGTTCGG - Intergenic
1034561080 7:151879556-151879578 CGGAATAGGCAGGACTTGTTTGG + Intergenic
1040873086 8:52120885-52120907 CAGAATTTGCAGGACTTGTGAGG + Intronic
1041876343 8:62691628-62691650 CAGAACATGCAGGACTTAATAGG - Intronic
1042150798 8:65781368-65781390 CAGATCATGCTGGACCTTTGTGG + Intronic
1042298241 8:67245197-67245219 CATTTCATGCAGGACATGTCTGG - Intronic
1043551192 8:81374953-81374975 CAGATCCTGTAGGACTTTGTGGG + Intergenic
1044462966 8:92468172-92468194 CTCATAATGCAGGAGTTGTTTGG + Intergenic
1044889826 8:96822607-96822629 CATATCATGCAGGACCTCCTGGG - Intronic
1045663092 8:104458270-104458292 CAGGTCATGCAGGACCTTATGGG - Intronic
1045977382 8:108145074-108145096 CAGATCATGCAGGACCCTCTTGG + Intergenic
1046048878 8:108997029-108997051 CAGATTATGATGGACTTCTTAGG - Intergenic
1046814417 8:118568383-118568405 CAGATCATGCAGGATCTGGTAGG + Intronic
1051555767 9:18380844-18380866 CAGCTCATGCTGCATTTGTTTGG - Intergenic
1052026669 9:23581221-23581243 GACATCATGGAGGGCTTGTTTGG - Intergenic
1053234951 9:36444991-36445013 TAGTTTATGCAGGATTTGTTTGG - Intronic
1053372921 9:37577429-37577451 CAGATCACGCAGCACTTAATAGG + Intronic
1055392530 9:75838390-75838412 CAGATCATGGAGAACCTGGTGGG - Intergenic
1055660122 9:78494872-78494894 CAGATCATGCAAGGCTTTGTGGG + Intergenic
1056368014 9:85925583-85925605 CAGATCATGAAGGGCTCTTTTGG - Intergenic
1056693711 9:88828803-88828825 CAGTTAATGCAGGGCTTGTAAGG + Intergenic
1058110376 9:101026436-101026458 CAGGTTATGCAGAGCTTGTTAGG + Intergenic
1059592187 9:115673675-115673697 CAGATCATGCATGGCTTTGTAGG - Intergenic
1060422999 9:123482907-123482929 TGGATCATGCAGGTCTTTTTAGG + Intronic
1060463655 9:123882931-123882953 CAGATCATGTAGGACTTTGTAGG - Intronic
1060888738 9:127174943-127174965 CTGATCATGCGGGACTTCTGTGG + Intronic
1062578031 9:137217623-137217645 CAGAGCAGGCAGGCCTTGCTGGG + Intergenic
1189705888 X:43758366-43758388 CAGATCATGTAGGAAGTCTTAGG - Intergenic
1190102747 X:47534785-47534807 CAGAGCATGGAGGACTTCTAGGG + Intergenic
1190302561 X:49065167-49065189 CTGATCATGCAGGATGTGGTCGG - Intronic
1190489342 X:50965394-50965416 CAGATCATGTAGGATTTTGTAGG - Intergenic
1190882193 X:54499600-54499622 TAGATTATGCAGGGCTTTTTAGG + Intergenic
1192043020 X:67643305-67643327 CAGATCAGGCAGGTCTTCTGGGG - Exonic
1192280119 X:69676116-69676138 CAGATCATGTAGGGCTTTGTAGG + Intronic
1193869473 X:86779422-86779444 CAGATCATGTAAGACTTTATAGG + Intronic
1194886887 X:99326968-99326990 CAGATCATTCATGACATGTTTGG - Intergenic
1195725717 X:107913912-107913934 AAAATCATGCAGGACTTTGTAGG - Intronic
1196071207 X:111524530-111524552 CAGAACATGCAGGCCTTCGTGGG + Intergenic
1196728308 X:118917062-118917084 CAGACCATGAAGGACTGGTAGGG + Intergenic
1197881749 X:131173841-131173863 CAGATCATGTAGGGCCTTTTAGG + Intergenic
1198320441 X:135514398-135514420 CAGATCATGCAGGGCCTAGTTGG - Intergenic
1198406107 X:136314340-136314362 CAGATCATGTAGTGCTTTTTAGG - Intronic
1198428559 X:136543402-136543424 CAGATCATGCAGGCCAAGGTTGG + Intronic
1198952314 X:142085374-142085396 CAGATCATTCATGACATGCTTGG - Intergenic
1200304118 X:155007729-155007751 CAGATCATGCGGCATTAGTTAGG - Intronic