ID: 957855345

View in Genome Browser
Species Human (GRCh38)
Location 3:85869514-85869536
Sequence GAAATCCCATATGAGATCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957855345_957855346 -3 Left 957855345 3:85869514-85869536 CCATAGATCTCATATGGGATTTC 0: 1
1: 0
2: 0
3: 15
4: 170
Right 957855346 3:85869534-85869556 TTCAACTTTCCTAATTTTTGTGG 0: 1
1: 0
2: 1
3: 38
4: 416
957855345_957855348 -1 Left 957855345 3:85869514-85869536 CCATAGATCTCATATGGGATTTC 0: 1
1: 0
2: 0
3: 15
4: 170
Right 957855348 3:85869536-85869558 CAACTTTCCTAATTTTTGTGGGG 0: 1
1: 0
2: 2
3: 30
4: 332
957855345_957855347 -2 Left 957855345 3:85869514-85869536 CCATAGATCTCATATGGGATTTC 0: 1
1: 0
2: 0
3: 15
4: 170
Right 957855347 3:85869535-85869557 TCAACTTTCCTAATTTTTGTGGG 0: 1
1: 0
2: 0
3: 27
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957855345 Original CRISPR GAAATCCCATATGAGATCTA TGG (reversed) Intronic
904442718 1:30542114-30542136 GAAATTCAAGATGAGATCTGGGG + Intergenic
905739956 1:40361545-40361567 GAAATGCCATCTAAGAGCTAAGG - Intronic
908406774 1:63821913-63821935 AAAATCCCATATGAGAACACAGG - Intronic
909135699 1:71797399-71797421 AATATCCAATATGAAATCTAAGG + Intronic
909137656 1:71821653-71821675 AAAATACCATATGATATCTGTGG + Intronic
909615709 1:77606056-77606078 GAAATGCCATCTAAGAGCTAAGG - Intronic
910603847 1:89061184-89061206 GAAATTTCATATGAAATTTATGG - Intronic
911332492 1:96541468-96541490 GGAATCATATATGAGTTCTATGG - Intergenic
911433804 1:97829078-97829100 TAAATTCCATAAGAAATCTAGGG - Intronic
914325216 1:146607453-146607475 GGAAATCCACATGAGATCTATGG - Intergenic
917003409 1:170385728-170385750 GAAATGTCATCTGAGAGCTAAGG + Intergenic
918811206 1:189123234-189123256 GAAAACCCCTATCAGATCTAGGG - Intergenic
919064469 1:192676121-192676143 TCAATCCCTTATGAGATATATGG - Intergenic
922308461 1:224365528-224365550 GACATCCCAAATTAGAGCTAGGG + Intronic
922388585 1:225114271-225114293 GAAATGTCATACAAGATCTAGGG + Intronic
1064600022 10:16984272-16984294 TACATCCCATGTTAGATCTATGG - Exonic
1067164903 10:43857464-43857486 GCAATCCCTTATTATATCTAAGG + Intergenic
1068156958 10:53212244-53212266 GTAATCCCATATCTGATATATGG + Intergenic
1068308304 10:55244466-55244488 TAAACCCCATGTGAGATTTATGG + Intronic
1068326507 10:55495355-55495377 GAAGTCCCTTATCAGATTTAAGG - Intronic
1075921499 10:126216956-126216978 GAAATCCCACATGACAATTAAGG + Intronic
1077849950 11:6066682-6066704 GAAATCTCTTCTGAGGTCTATGG - Intergenic
1078626073 11:12959574-12959596 GATAGACCATATGAGATCAATGG - Intergenic
1079332106 11:19542071-19542093 GGATTCCCATATGAGGTCAATGG - Intronic
1080244849 11:30168350-30168372 GAAATCTCATATGAGATTCTGGG - Intergenic
1083133052 11:60644933-60644955 TAAATCCCTTATCAGATATATGG + Intergenic
1083505863 11:63156825-63156847 GAAATGTCATCTGGGATCTAGGG + Intronic
1084170678 11:67399475-67399497 GACTTCCCAGATGAGACCTAAGG + Intronic
1087532971 11:99407339-99407361 GAAATGTCATCTGCGATCTAGGG + Intronic
1092925686 12:13270000-13270022 GAAAGACCAGATGAGATCCAAGG - Intergenic
1094243771 12:28262154-28262176 GGAACCCCTTAAGAGATCTAAGG + Intronic
1094304613 12:29004261-29004283 GAAATCACATATCTGATCTTTGG - Intergenic
1095312045 12:40710645-40710667 GAAATCTAATATCTGATCTAAGG + Intronic
1096935972 12:55276746-55276768 TAAATCCCATATCAGATATAAGG - Intergenic
1097147044 12:56948904-56948926 GAAATGTCATATGGGAGCTAGGG + Intergenic
1098455623 12:70669929-70669951 GAAAGCTCATATGATACCTATGG - Intronic
1098667273 12:73180008-73180030 GAAGTGCCATCTGAGAGCTAGGG + Intergenic
1109419397 13:62090699-62090721 GGAATCCATTATGAGATATATGG + Intergenic
1109478570 13:62917875-62917897 GAAATCATATATGAAAACTAGGG - Intergenic
1109568384 13:64151069-64151091 TTAATCCCTTATGAGATGTATGG + Intergenic
1109619346 13:64880534-64880556 GCAATCCCGTATAATATCTAGGG + Intergenic
1111785677 13:92783758-92783780 GTGATCCCATATGACATCTTAGG + Intronic
1112978287 13:105348486-105348508 GAAATCCAATATGATGTCAAGGG + Intergenic
1116114948 14:40635919-40635941 GAAATGTCATCTGGGATCTAAGG - Intergenic
1116351770 14:43871900-43871922 GAAATGTCATCTGAGAGCTAGGG + Intergenic
1116855812 14:49951438-49951460 GAAATACTAGGTGAGATCTAAGG - Intergenic
1117002951 14:51390214-51390236 GTAATCCCTTATCAGATATATGG + Intergenic
1119521266 14:75287547-75287569 AAAATCCCATTTGAGTTCAATGG + Intergenic
1119562202 14:75599606-75599628 GAAATCCCATATGAATTTTAGGG - Intronic
1120312933 14:82854497-82854519 AAACTGCCATATGAAATCTAAGG + Intergenic
1126709480 15:51441403-51441425 GAAATGTCATCTGAGAGCTAGGG + Intergenic
1127170968 15:56300390-56300412 GAAATGCCATATAAGAGCCAGGG - Intronic
1128723115 15:69967438-69967460 GAAATGCCATATGACATCATTGG - Intergenic
1131105750 15:89733118-89733140 GAAATCCCAAATGAAATGTGTGG + Exonic
1135966298 16:27037981-27038003 GAACTCACATATTAGTTCTAGGG - Intergenic
1140008347 16:71103494-71103516 GGAAATCCACATGAGATCTATGG + Intronic
1142001963 16:87669303-87669325 GAAATCCCAGATGGGATGTCTGG + Intronic
1146364487 17:32210394-32210416 GAAATCAGATATGAAATTTAGGG - Intronic
1148800153 17:50220108-50220130 GAAATCCCATAGGGAATCCAGGG + Intergenic
1150163494 17:62919265-62919287 CAAATTCCATATTAGAGCTAGGG + Intergenic
1155140526 18:23040184-23040206 GAAATCTCATATGAGACTTCAGG + Intergenic
1155443360 18:25884897-25884919 GAAATGTCATCTGAGAGCTAGGG - Intergenic
1156428170 18:37039086-37039108 GAAATCCCATATAAGAAAAAAGG - Intronic
1156585551 18:38427260-38427282 GGAAGCCCATATCAGATCTCAGG + Intergenic
1158404495 18:57148915-57148937 GTCATCCCTTATGAGATCTATGG - Exonic
1163201936 19:15776010-15776032 GAAAACCCACAGGAGAACTAGGG - Intergenic
1163737180 19:18988562-18988584 GAAATAGCATATGAGAACAAAGG - Intergenic
1165984015 19:39751737-39751759 GAAATGCCATCTGGGAGCTAGGG - Intergenic
926940644 2:18132909-18132931 GAAATCATATATGAGACCTACGG - Intronic
927383193 2:22502447-22502469 GAAATCCCACATGAAATGAAGGG - Intergenic
929254975 2:39800600-39800622 CAAAACCCATAAGAGATCTTTGG - Intergenic
930439709 2:51390703-51390725 GAAATGTCATCTGAGAGCTAGGG + Intergenic
933341684 2:81033926-81033948 GAAATGTGATATGAGAGCTAGGG + Intergenic
933787555 2:85855685-85855707 GAAATCACATACCAGATATAGGG + Intronic
936004372 2:108869599-108869621 GGAATACCATACAAGATCTAAGG + Intronic
936511326 2:113149884-113149906 GAAATGTCATCTGAGAGCTAGGG + Intergenic
938037075 2:128043764-128043786 GAAATCTCATTTCAGACCTAGGG + Intergenic
938953046 2:136274524-136274546 AAAATCCCTTATCAGATATATGG - Intergenic
940491417 2:154366645-154366667 GAATTCTCAGATGAGAACTAAGG + Intronic
941528280 2:166632524-166632546 GAAATATCATCTCAGATCTAGGG + Intergenic
942719965 2:178940376-178940398 AAAAAACAATATGAGATCTATGG + Intronic
942768047 2:179480608-179480630 GAATTCCCACATGAGTTTTATGG - Intronic
942964269 2:181871302-181871324 GAAAAACCATTTGAGATCTGAGG - Intergenic
943237175 2:185337650-185337672 GAAATACCATCTGAGAGCTAAGG + Intergenic
945551707 2:211228956-211228978 GAAATGTCATCTGAGGTCTAGGG - Intergenic
946533198 2:220595991-220596013 GAATTCACTTATTAGATCTAGGG - Intergenic
946587044 2:221201343-221201365 GAATGCCCATCTGAGATCTGTGG + Intergenic
1169312604 20:4558898-4558920 CAAATCCCATATTAGGTATATGG - Intergenic
1169922251 20:10747832-10747854 GAAATCTAATCTGAGATCCAAGG + Intergenic
1177410027 21:20717955-20717977 TAAATCCCATATGCCAGCTAAGG + Intergenic
1182511559 22:30823687-30823709 GAAACACCATATGAGGTCTTAGG + Intronic
950695621 3:14699180-14699202 GAAATGCCATCTGAGAGCCAAGG + Intronic
951557287 3:23933567-23933589 CAAACCCCATATGTGATATAAGG - Intronic
952139862 3:30466384-30466406 GAAATGCCATCTGGGAGCTAGGG + Intergenic
954286889 3:49625565-49625587 GAAATCCCTTGGGAGATCTGGGG - Intronic
957855345 3:85869514-85869536 GAAATCCCATATGAGATCTATGG - Intronic
958828966 3:99065222-99065244 GAAATCCCACATGAGATCAGAGG - Intergenic
959118543 3:102206366-102206388 GAAATGCCATCTGAGAACTAGGG + Intronic
959466431 3:106693009-106693031 GAAGTCTCATTTGAGATCTCAGG + Intergenic
960153462 3:114274616-114274638 GAGATGCCATTTGGGATCTAGGG + Intergenic
961710082 3:128821543-128821565 TTAATCCCTTATGAGATATATGG - Intergenic
962806425 3:138930601-138930623 GAGATCCCAAATGAAGTCTAGGG - Intergenic
962810025 3:138951663-138951685 GATATCCCTCATGACATCTATGG + Exonic
963211141 3:142692347-142692369 GAAATTGTATATCAGATCTAGGG + Intronic
968005041 3:195236879-195236901 GAAATGTCATCTAAGATCTAGGG + Intronic
971689393 4:29813359-29813381 GAAATACCACATCAGATCAAAGG + Intergenic
972253832 4:37332805-37332827 GAAATACCATCTGAGAGCCAAGG - Intronic
972443867 4:39124309-39124331 GCAATCCCATATAAATTCTAGGG - Intronic
972850742 4:43047317-43047339 GAAATTCGATATGAGATGAATGG - Intergenic
975503868 4:75117097-75117119 GAAATCTCATTTGGGAGCTAGGG - Intergenic
975629246 4:76382978-76383000 GACACCCCCAATGAGATCTAGGG + Intronic
978959161 4:114654750-114654772 GTAATCCTATGTGAGTTCTAAGG - Intronic
980686793 4:136240060-136240082 GAAATGCCATCTGGGAGCTAGGG - Intergenic
981975528 4:150723416-150723438 GAAATATCATCTGAGAGCTAAGG - Intronic
983892860 4:173048716-173048738 CAAAGCCCATATGAGTTGTATGG + Intergenic
984891047 4:184493194-184493216 TAAATCTCATATAAGATATAAGG + Intergenic
988295723 5:29358762-29358784 AAAATCCCTTATGAGATATATGG + Intergenic
991663579 5:68974292-68974314 GAAATGCCATCTGGGAGCTAGGG - Intergenic
991929709 5:71741732-71741754 GAAATGGTATATGAGATCTCAGG - Intergenic
992089993 5:73308281-73308303 GAAAGACAATTTGAGATCTAAGG - Intergenic
992810557 5:80383608-80383630 GTAATACCATATCAGTTCTATGG + Intergenic
993138364 5:83998653-83998675 GAAATGCCATTTGGGAACTAGGG - Intronic
998062350 5:139128801-139128823 GAAATGTCATATGAGTTTTAGGG - Intronic
999912232 5:156215423-156215445 TTAATCCCTTATGAGATGTATGG - Intronic
1000473078 5:161670705-161670727 TAAATCCCATTTGAGACCAAAGG - Intronic
1000806831 5:165805767-165805789 GAAATGTCATCTGAGAGCTATGG + Intergenic
1002564649 5:180103559-180103581 GAACTCCCTTATTAGTTCTAGGG + Intronic
1003757838 6:9142198-9142220 GAAATCCGAAATGAGATTTCTGG + Intergenic
1008198863 6:48561083-48561105 GAAATCCAATCTGAGTTTTAAGG + Intergenic
1008747693 6:54692743-54692765 GACATCTCATCTGAGATCGAGGG + Intergenic
1009373564 6:62938854-62938876 GAAATACCATCTGTGAGCTAGGG + Intergenic
1010288550 6:74108592-74108614 GAAAACCCATAACATATCTATGG + Intergenic
1010597467 6:77781492-77781514 CAAACCCCATCTCAGATCTATGG + Intronic
1010860861 6:80909209-80909231 TAAATCCTATATAAAATCTAGGG + Intergenic
1010937014 6:81874239-81874261 CAAATTCCATATGAAATTTAAGG - Intergenic
1011072156 6:83397221-83397243 TTAATCCCTTATGAGATGTATGG - Intronic
1011090169 6:83588929-83588951 AAATTCCCATTTGAGATCTGTGG + Intronic
1011945672 6:92899055-92899077 GAAAGCCTATATGAGAGCTAGGG + Intergenic
1012057066 6:94426671-94426693 GAAATGTCATATGGGAGCTATGG + Intergenic
1012717769 6:102698870-102698892 GAAATGCCATCTAAGATCCATGG + Intergenic
1013161480 6:107549460-107549482 GAAACCCCATAAGGCATCTAGGG - Intronic
1014931460 6:127341653-127341675 GAAAGTCCATCTGAGATCAAAGG + Intronic
1016798261 6:148141367-148141389 GAAATCCCATATGGGAGCAAAGG - Intergenic
1018504146 6:164445726-164445748 GAAATGGCATATGAAATTTAAGG - Intergenic
1021046101 7:15924948-15924970 GAAATGTCATCTGAGAGCTAGGG - Intergenic
1021898831 7:25263131-25263153 GAAGTCCCACATGAGAGCAAAGG - Intergenic
1023635926 7:42210153-42210175 GAAGCCCAATATGAAATCTAAGG - Intronic
1023929732 7:44697909-44697931 GACATCCCATCTGAGATGGATGG - Intronic
1024730055 7:52243749-52243771 GAATTCCCATATCAGCTCTCTGG - Intergenic
1027469497 7:78555414-78555436 GAAATTTCATATGAGATATATGG + Intronic
1028116910 7:87008361-87008383 GAAATGCAATGTGAGATCTTAGG + Intronic
1031239692 7:119220945-119220967 GAAATCCCTTACAAGAGCTAAGG - Intergenic
1032099723 7:128964284-128964306 GAAATTCCATATGAATTTTAGGG - Intronic
1033167170 7:139050115-139050137 TTAATCCCATATCAGATGTATGG + Intronic
1039448647 8:37652976-37652998 GATATTCCATATGAGTTTTATGG - Intergenic
1040056362 8:43061118-43061140 AAAATCCCATATGAAATGTATGG - Intronic
1040848091 8:51866930-51866952 GCAATCCCTTATCAGATGTATGG - Intronic
1041823232 8:62063229-62063251 GAAATGTCATGTGAGAGCTATGG - Intergenic
1041902674 8:62999113-62999135 GTAATCCCTTATCAGATGTATGG + Intronic
1042082579 8:65071366-65071388 GAAATATCATCTGAGAACTAGGG + Intergenic
1042182720 8:66107945-66107967 GAAGTGGCATATGAGATCTTAGG - Intergenic
1042428147 8:68672983-68673005 GAAATGTCATCTGAGAGCTAGGG - Intronic
1046726242 8:117677481-117677503 GAAATACCATATGATATATGGGG + Intergenic
1048118744 8:131555295-131555317 GAAATGTCATTTGGGATCTAGGG - Intergenic
1048355806 8:133653339-133653361 GAGATCCCAAATGTCATCTAGGG + Intergenic
1050030417 9:1379818-1379840 GAACTCCCATATTAGTTCCATGG + Intergenic
1050792733 9:9494813-9494835 GAAATCCCATATGAATTTTAAGG - Intronic
1052030964 9:23628496-23628518 GAAAACTCAGATCAGATCTAAGG + Intergenic
1052886830 9:33657426-33657448 GACAACCCTTATGAAATCTAAGG + Intergenic
1055387236 9:75775665-75775687 GAAATGTCATCTGGGATCTAGGG - Intergenic
1058123781 9:101168365-101168387 AACATCCCATATCATATCTATGG - Intronic
1058259889 9:102815114-102815136 GACACCTCATAGGAGATCTATGG + Intergenic
1059718698 9:116937413-116937435 GAAGTCCCAAATGAGATCTGAGG - Intronic
1188359757 X:29238509-29238531 GAAATGGCATATGAGATTGAGGG - Intronic
1188927221 X:36059202-36059224 GAAATCTCCTAAGAGATATAAGG + Intronic
1192234737 X:69288679-69288701 GAGATCCCATCTAAGATTTAGGG - Intergenic
1192744474 X:73925331-73925353 TAAATCCCTTATCAGATGTATGG + Intergenic
1193692784 X:84667990-84668012 GAAATTTCATCTGAGAACTAGGG - Intergenic
1194546355 X:95239621-95239643 GAAATGTCATCTGAGAGCTAGGG - Intergenic
1194961522 X:100241903-100241925 TTAATCCCTTATGAGATATATGG - Intergenic
1196417547 X:115487587-115487609 AAAATTCCATATGAGATTTTTGG + Intergenic
1196512127 X:116524078-116524100 GAAATGCCATCTGGGAGCTAGGG + Intergenic
1197488795 X:127090112-127090134 GAGATGCCATATGAGAGCCAGGG + Intergenic
1197676356 X:129334911-129334933 GAAATGTCATCTGAGAGCTAGGG - Intergenic
1198624868 X:138559521-138559543 GAAATCCCATATAAAATTGAAGG + Intergenic
1202094122 Y:21227279-21227301 CAAATTCCACATGACATCTATGG - Intergenic