ID: 957855375

View in Genome Browser
Species Human (GRCh38)
Location 3:85869802-85869824
Sequence GTGCCCGCCACCACGGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 237}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957855363_957855375 18 Left 957855363 3:85869761-85869783 CCATTCTCTTCCCTCAGCCTCCC 0: 10
1: 1582
2: 64699
3: 46342
4: 21378
Right 957855375 3:85869802-85869824 GTGCCCGCCACCACGGGGCCTGG 0: 1
1: 0
2: 2
3: 30
4: 237
957855364_957855375 8 Left 957855364 3:85869771-85869793 CCCTCAGCCTCCCAAGTAGCTGG 0: 1096
1: 2321
2: 3262
3: 4433
4: 5876
Right 957855375 3:85869802-85869824 GTGCCCGCCACCACGGGGCCTGG 0: 1
1: 0
2: 2
3: 30
4: 237
957855371_957855375 -3 Left 957855371 3:85869782-85869804 CCAAGTAGCTGGGACTACAGGTG 0: 27099
1: 99923
2: 128146
3: 148395
4: 176885
Right 957855375 3:85869802-85869824 GTGCCCGCCACCACGGGGCCTGG 0: 1
1: 0
2: 2
3: 30
4: 237
957855362_957855375 30 Left 957855362 3:85869749-85869771 CCTGGGTTCACGCCATTCTCTTC 0: 6
1: 853
2: 39556
3: 54596
4: 128661
Right 957855375 3:85869802-85869824 GTGCCCGCCACCACGGGGCCTGG 0: 1
1: 0
2: 2
3: 30
4: 237
957855368_957855375 1 Left 957855368 3:85869778-85869800 CCTCCCAAGTAGCTGGGACTACA 0: 41507
1: 154089
2: 219927
3: 224998
4: 456875
Right 957855375 3:85869802-85869824 GTGCCCGCCACCACGGGGCCTGG 0: 1
1: 0
2: 2
3: 30
4: 237
957855366_957855375 7 Left 957855366 3:85869772-85869794 CCTCAGCCTCCCAAGTAGCTGGG 0: 89011
1: 200457
2: 243521
3: 257984
4: 301655
Right 957855375 3:85869802-85869824 GTGCCCGCCACCACGGGGCCTGG 0: 1
1: 0
2: 2
3: 30
4: 237
957855370_957855375 -2 Left 957855370 3:85869781-85869803 CCCAAGTAGCTGGGACTACAGGT 0: 13442
1: 93053
2: 234640
3: 257908
4: 243807
Right 957855375 3:85869802-85869824 GTGCCCGCCACCACGGGGCCTGG 0: 1
1: 0
2: 2
3: 30
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957855375 Original CRISPR GTGCCCGCCACCACGGGGCC TGG Intronic
900001086 1:15226-15248 CTCCCAGCCACCTCGGGGCCAGG + Intergenic
900020801 1:185747-185769 CTCCCAGCCACCTCGGGGCCAGG + Intergenic
900213534 1:1468780-1468802 GTGGCTGCCACGGCGGGGCCGGG + Exonic
900221094 1:1509596-1509618 GTGCCTGCCACGGCAGGGCCGGG + Intergenic
900226236 1:1534828-1534850 GTGCCCGCCACTGCGGGGCCAGG + Intergenic
900339803 1:2182640-2182662 GTGCCAGCCAGGATGGGGCCGGG - Intronic
900585045 1:3428617-3428639 GTTCCCGCCACCCCAGGGACTGG - Intronic
900992179 1:6103200-6103222 GTGGCCAGCACCCCGGGGCCCGG - Exonic
901264582 1:7900633-7900655 GCGCCAGCCACCACTGTGCCTGG - Intergenic
901836196 1:11925732-11925754 GGGCCGGCGGCCACGGGGCCAGG + Exonic
904140349 1:28348157-28348179 GTGCCCGCCACCACCACGCCTGG - Intergenic
904228553 1:29046268-29046290 GTGCACGCCACCACCATGCCCGG + Intronic
905058524 1:35119852-35119874 GTGCCTGCCACCACCACGCCTGG - Intergenic
905120054 1:35674879-35674901 GTGCCCGCCACCACCACACCTGG - Intergenic
906034266 1:42740867-42740889 CTGCCGGCCAGCAAGGGGCCTGG + Intergenic
907909602 1:58814792-58814814 TTTCACGCCACCGCGGGGCCCGG - Intergenic
908369150 1:63463101-63463123 GTGCACGCCACCACCATGCCTGG - Intronic
908623910 1:66018272-66018294 GCGCCCGCCACCACCATGCCCGG - Intronic
909425208 1:75516369-75516391 GCGCCCGCCACCACCACGCCCGG - Intronic
909615803 1:77606569-77606591 GTGGCCACCACCACTGGGACTGG - Intronic
915368638 1:155329810-155329832 GTGCCCACCACCACCACGCCTGG - Intronic
919901558 1:202047562-202047584 GGGACCGCCAGCACGGGGGCAGG - Intergenic
919974332 1:202600874-202600896 GTGTCCACCACCAAGGGCCCTGG + Intronic
922421250 1:225462329-225462351 GTTCCCACCACCATGGGCCCTGG - Intergenic
922804245 1:228377443-228377465 GTGGCCCCCACCCCGGAGCCTGG + Intronic
924238672 1:242021001-242021023 GTGCCAGCCACGGCGGTGCCCGG + Intergenic
924775270 1:247111653-247111675 GCGACCCCCACCACGGGCCCCGG - Exonic
1065499390 10:26364348-26364370 GTGCCCACCACCACCACGCCAGG - Intergenic
1067267006 10:44755231-44755253 GTGCACGCCACCACCAAGCCTGG + Intergenic
1070811902 10:79302314-79302336 GTGCATGTCACCACCGGGCCTGG + Intronic
1072684855 10:97530149-97530171 GTGTTCCCCAGCACGGGGCCTGG + Intronic
1076099002 10:127758890-127758912 GAGCCCGCATCCACGGGGGCAGG - Intergenic
1076258375 10:129046338-129046360 GCGCCCGGCTCCCCGGGGCCGGG + Intergenic
1076533827 10:131163131-131163153 GTGGCCTCCACCCCGGTGCCCGG - Exonic
1076875926 10:133215471-133215493 GGGCACGCCAGCACGGGGCGTGG + Intronic
1076894292 10:133302330-133302352 GTGAGCGCCACCCCGGGGTCAGG - Intronic
1077837302 11:5936349-5936371 ATGCCCGCCAGCAAGGTGCCAGG + Intronic
1077915136 11:6606741-6606763 CTGCCTGCCACCTCAGGGCCTGG - Intronic
1078175375 11:8965581-8965603 GCGCCCGCCACCACGCCGCCCGG + Intergenic
1080588329 11:33700494-33700516 GCCCCCGCCACCACCCGGCCTGG - Exonic
1080643953 11:34174688-34174710 CTCCCCGCCACCGAGGGGCCCGG + Intronic
1083191935 11:61058398-61058420 GCGCCCGCCACCACCATGCCCGG + Intergenic
1084055736 11:66631428-66631450 GTGCCTGCCACCACCTCGCCTGG + Intronic
1084338306 11:68475500-68475522 GTGCCCGCCACCTCCCGGACGGG + Intronic
1085252988 11:75155736-75155758 GTGTGAGCCACCACGAGGCCAGG + Intronic
1085371276 11:76008051-76008073 GCGCCCGCCACCACGATGCCTGG + Intronic
1087664197 11:101024260-101024282 GCGCCCGCCACCACGCCCCCTGG - Intergenic
1088943244 11:114482080-114482102 GTGCCAGCCACCACTTGCCCAGG - Intergenic
1089430776 11:118422706-118422728 GTGCCCGCCACCACCACGCCCGG + Intronic
1089829218 11:121310601-121310623 GTGCCCGCCACCACCACGCCCGG + Intergenic
1089988875 11:122839072-122839094 GTGCCCGCCACCACCACGCCCGG + Intronic
1091374175 12:15341-15363 CTCCCAGCCACCTCGGGGCCAGG + Intergenic
1093436102 12:19137176-19137198 GTGCCCACCACCACCACGCCTGG + Intronic
1095390874 12:41705012-41705034 GTGCCCACCACCACCGCGCCTGG + Intergenic
1103432963 12:120903904-120903926 GAGCCCGCCGCCGCCGGGCCCGG - Exonic
1103610724 12:122122685-122122707 GCGCCCGCCACCACGACGCCTGG + Intronic
1104846837 12:131851182-131851204 GTGGCAGCCACCAGTGGGCCTGG - Exonic
1105482714 13:20793697-20793719 GTGCCCACCACCACCATGCCTGG + Intronic
1105502426 13:20984074-20984096 GTGCCCGCCACCATGACACCTGG + Intronic
1106555161 13:30803115-30803137 GTGCCTGCCACCCCAGGGCGCGG - Intergenic
1106822547 13:33481834-33481856 GCGCCCGCCACCACCACGCCCGG - Intergenic
1107853228 13:44591278-44591300 GGGGCCGCCACAATGGGGCCTGG + Intergenic
1108572483 13:51765118-51765140 GTTCCTGCCTCCACAGGGCCAGG - Exonic
1112565033 13:100545420-100545442 GTGCCCTCCTCCAGGGGCCCTGG - Intronic
1113445197 13:110360787-110360809 CCGCCCCCCACCCCGGGGCCTGG + Intronic
1113782021 13:112982360-112982382 GTGGCCGCATCCATGGGGCCTGG + Intronic
1117146296 14:52839754-52839776 GCGCCTGCCACCACGGTGCCTGG + Intergenic
1118328812 14:64800226-64800248 ATGCCAGCCACTAGGGGGCCAGG + Intronic
1118994121 14:70821865-70821887 CTGCCCCCCAACACGGGGACCGG + Intergenic
1119273528 14:73331400-73331422 GTGCCCACCACCACCACGCCCGG - Intronic
1121408278 14:93732631-93732653 GTGCCCGCCAGGGCTGGGCCAGG - Intronic
1121854692 14:97256456-97256478 ATGCCCCCCAGCACTGGGCCAGG - Intergenic
1122127268 14:99586125-99586147 GTGCAGGGCAACACGGGGCCAGG + Intronic
1122799240 14:104221536-104221558 ATGCCACCCACCACGTGGCCTGG - Intergenic
1123405558 15:20017834-20017856 GTGCACGCCAGCACAGGCCCTGG - Intergenic
1123411949 15:20067887-20067909 CTGCCTGCCTCCCCGGGGCCTGG - Intergenic
1123514889 15:21024482-21024504 GTGCACGCCAGCACAGGCCCTGG - Intergenic
1123521293 15:21075006-21075028 CTGCCTGCCTCCCCGGGGCCTGG - Intergenic
1123661984 15:22572569-22572591 GTGGCCGCCACCACAGTGCCTGG + Intergenic
1123737024 15:23195479-23195501 GCGCCCACCACCACCAGGCCAGG - Intergenic
1123996420 15:25721009-25721031 GTCCCCGCCACCACTGTGCCTGG - Intronic
1124262233 15:28202976-28202998 GTGGCCGCCACCACAGTGCCTGG - Intronic
1124287722 15:28418455-28418477 GCGCCCACCACCACCAGGCCAGG - Intergenic
1124288243 15:28424156-28424178 GCGCCCACCACCACCAGGCCAGG - Intergenic
1124294982 15:28493171-28493193 GCGCCCACCACCACCAGGCCAGG + Intergenic
1124315781 15:28666812-28666834 GTGGCCGCCACCACAGTGCCTGG + Intergenic
1126100968 15:45117965-45117987 GTGCCCGCCAGGCCTGGGCCAGG + Exonic
1128986798 15:72228235-72228257 GTGCCCGCTACAAAAGGGCCAGG + Intronic
1128992477 15:72272455-72272477 GTGGCCGCCACCACGGGCACAGG - Exonic
1130041248 15:80406617-80406639 GTGCTTCACACCACGGGGCCAGG - Intronic
1132691722 16:1184580-1184602 CTGCCTTCCACCAGGGGGCCTGG - Intronic
1132814519 16:1819354-1819376 GTGCTCCCCACCACGGGACTGGG + Intronic
1134274208 16:12761129-12761151 GTGCCTGCCACCACGCAGCTTGG - Intronic
1134531830 16:14989655-14989677 GGGCCGGCGGCCACGGGGCCAGG + Intronic
1135004006 16:18801989-18802011 ATCCCAGCCACCTCGGGGCCAGG - Intergenic
1136022404 16:27448620-27448642 CTGCCACCCACCACGGAGCCCGG + Exonic
1138432959 16:56981274-56981296 GTGCCTGACTCCAAGGGGCCAGG - Intronic
1138558498 16:57786639-57786661 CTGCCCTCCACCTCGGAGCCTGG + Intronic
1139217274 16:65138888-65138910 GTGCCCGCCGCCACCACGCCTGG - Intergenic
1140442737 16:74999643-74999665 GTTCCCGCCCCACCGGGGCCCGG + Exonic
1141979533 16:87541344-87541366 TTGCCGGCCTCCACGGGCCCTGG - Intergenic
1142067455 16:88071102-88071124 GTGCCCCACCCCACGGAGCCTGG - Intronic
1142722389 17:1785278-1785300 GCGCCCGCCACCACCATGCCCGG - Intronic
1142745865 17:1957696-1957718 GTGCCCGCCACCAACATGCCCGG - Intronic
1143019301 17:3908416-3908438 GTGCCCGCCACCACCATGCCCGG - Intronic
1143497814 17:7322521-7322543 TTCCCTGCCACCAAGGGGCCAGG - Intronic
1144009543 17:11133519-11133541 GTGCCCGCCACCACCACGCCTGG - Intergenic
1144260103 17:13510155-13510177 GTGGCAGCCACCACAGAGCCAGG - Intronic
1144479422 17:15616661-15616683 GTGCCTGCCACCACCACGCCCGG - Intronic
1144948616 17:18982336-18982358 GGGCCCCACCCCACGGGGCCTGG + Intronic
1145925765 17:28645369-28645391 GTGCCCGGAACCGCGGGGCTCGG + Intronic
1146049948 17:29542018-29542040 GGGCCCGCCACCACCATGCCCGG + Intronic
1146197678 17:30826993-30827015 GTGCGCGCCACCACCAAGCCCGG - Intergenic
1146619868 17:34389018-34389040 GTCCCTGCCACCACGGGGAAAGG - Intergenic
1147160990 17:38569347-38569369 GTGCCAGGCACCCCCGGGCCAGG - Intronic
1149614649 17:57988013-57988035 CCGCCCGCCAGCCCGGGGCCCGG + Intronic
1150046068 17:61914555-61914577 GCGCCCGCCACCACCACGCCCGG - Intronic
1150237256 17:63603088-63603110 GCGCCCGCCACCACCACGCCTGG - Intronic
1150670428 17:67191595-67191617 GTGCCTGCCACCACAATGCCCGG + Intronic
1151619941 17:75239482-75239504 CTGCCCTTCTCCACGGGGCCCGG - Exonic
1152887611 17:82861540-82861562 GTGCGCGGCACACCGGGGCCGGG - Intronic
1153522158 18:5963440-5963462 GTGGAGGCCACCACGGGGCAGGG - Intronic
1155187550 18:23400479-23400501 GTGCTCGCCACCACCATGCCTGG - Intronic
1158462432 18:57658190-57658212 GTGCCCGCCACCCCCATGCCCGG + Intronic
1160155546 18:76431484-76431506 GTGCCCGGCATGACGGGGCTTGG + Intronic
1160991863 19:1863388-1863410 GGGCCCGCGCCCTCGGGGCCGGG + Exonic
1161018704 19:1997498-1997520 GTGGCCGCCACCCCACGGCCGGG + Intronic
1161997942 19:7725649-7725671 GCGCCCGCCACCACCATGCCTGG - Intergenic
1162362819 19:10230174-10230196 GTGCGGGCCAGCACGGGGTCGGG - Intronic
1162546154 19:11331147-11331169 GCACCCACCACCACGGGGCCTGG - Intronic
1162790298 19:13059348-13059370 GAGCCCCCCAGCACAGGGCCTGG + Intronic
1163006907 19:14402593-14402615 ATGCCCGCCACGGCGGGGCCTGG - Exonic
1163145955 19:15379486-15379508 CCGCCCGCCTCCTCGGGGCCTGG + Intronic
1165061258 19:33206372-33206394 GTGCCCGCAGCCAGGGGACCGGG + Intronic
1165763401 19:38335869-38335891 GTGACTGGTACCACGGGGCCGGG + Exonic
1166364696 19:42272564-42272586 GTGCCCACCACCAGGGCACCTGG - Intronic
1166391068 19:42409197-42409219 CAGCCAGCCACCACGGGGGCAGG + Intronic
1166807671 19:45496876-45496898 GCGCCCGCGACCCCGGGCCCAGG - Exonic
1166912254 19:46167384-46167406 CTACCTGCCACCACGGAGCCAGG - Intergenic
1167112956 19:47472596-47472618 GTGCCCGCCACCACCACGCCAGG + Intergenic
1167112987 19:47472740-47472762 GTGCCCACCACCACCACGCCAGG + Intergenic
1168312452 19:55467754-55467776 GGGCCCGCCGCCACGTGGCTGGG + Intergenic
926199243 2:10781330-10781352 GCGCCCGCCACCACCACGCCAGG - Intronic
927181112 2:20447326-20447348 GAACGCGCCACCGCGGGGCCCGG + Exonic
927538071 2:23880415-23880437 GTGCCCGCCACCATGAGGTCAGG - Intronic
928524068 2:32121684-32121706 GTGCCCACCACCACCATGCCCGG + Intronic
932607813 2:73176278-73176300 GTGCCCGCGACCGCAGGGCGGGG + Intergenic
933559872 2:83875992-83876014 ATGCCCGCCAGCAGGGTGCCAGG - Intergenic
935640173 2:105282679-105282701 GTGTATGCCACCACGGGACCTGG - Intronic
938258743 2:129880484-129880506 GAGCTCACCATCACGGGGCCGGG - Intergenic
944572912 2:201062503-201062525 GTGCCCGCCACCACCACGCCTGG - Intronic
946929268 2:224656050-224656072 GTGCCCGCCACTGCGCCGCCTGG + Intergenic
948468625 2:238163888-238163910 GCGCCCGCGGCCCCGGGGCCAGG - Exonic
948600699 2:239106119-239106141 GTGCCAGCCACGACTGGGCCAGG - Intronic
1169214716 20:3786490-3786512 GCGCCCCCCGCCCCGGGGCCCGG + Exonic
1169214750 20:3786542-3786564 GTGCCCCCCGCCACGGGCCCGGG - Exonic
1170891531 20:20380276-20380298 GCGCCTGCCACCACGTGCCCAGG + Intergenic
1171974668 20:31586985-31587007 GCGCCCGCCACCACCACGCCCGG + Intergenic
1173126987 20:40346194-40346216 GTGGCCACCACCACTGGGGCTGG - Intergenic
1173488385 20:43458174-43458196 GTTCCCGCCGCCACCAGGCCTGG - Intronic
1175916279 20:62427433-62427455 GTACCCGGGACCCCGGGGCCAGG - Intronic
1176384569 21:6132448-6132470 GTGCCAGCCGCCCCGGGGTCAGG + Intergenic
1176548624 21:8212315-8212337 GTTCCCGCCCCCACGGCGCGGGG - Intergenic
1176556518 21:8256523-8256545 GTTCCCGCCCCCACGGCGCGGGG - Intergenic
1176567555 21:8395350-8395372 GTTCCCGCCCCCACGGCGCGGGG - Intergenic
1176575457 21:8439565-8439587 GTTCCCGCCCCCACGGCGCGGGG - Intergenic
1179738903 21:43405804-43405826 GTGCCAGCCGCCCCGGGGTCAGG - Intergenic
1180043713 21:45293259-45293281 AGGGCCGCCCCCACGGGGCCAGG - Intergenic
1180224808 21:46386066-46386088 GTGGCAGCAGCCACGGGGCCAGG - Intronic
1180871872 22:19150841-19150863 CTGCCCGCCACCTCGGAGCCAGG + Intergenic
1181081720 22:20419934-20419956 GTGCACACCACCACCGTGCCTGG + Intergenic
1181531545 22:23520367-23520389 GTGCCCGCCACCCCGCAACCCGG + Intergenic
1181789873 22:25256810-25256832 GTGCCCGCCACCACCACGCCTGG + Intergenic
1182613372 22:31568384-31568406 GTGCCCACCACCACCATGCCCGG - Intronic
1183380049 22:37486150-37486172 GTGCCGGCTCCCGCGGGGCCTGG - Exonic
1183475636 22:38034388-38034410 CTGCCTGCCGCCACGTGGCCAGG - Intronic
1183821611 22:40350762-40350784 GCGCCTGCCACCACGCCGCCTGG + Intronic
1184768461 22:46584786-46584808 GTGCCCGTCCCTGCGGGGCCGGG - Intronic
1184924900 22:47630093-47630115 GAGCCAGCCCCCACGGAGCCAGG + Intergenic
1185132158 22:49045369-49045391 GTGGCCGTGACCACGGGGACGGG - Intergenic
1185287602 22:50009515-50009537 GTGGCCGCCCCCAGGGGGCCTGG - Intronic
1185344181 22:50304240-50304262 ATCCCCGGCACCACTGGGCCTGG + Intronic
1185351723 22:50343193-50343215 GTGCCCCACTCCAGGGGGCCCGG + Intergenic
1203253507 22_KI270733v1_random:128620-128642 GTTCCCGCCCCCACGGCGCGGGG - Intergenic
1203261562 22_KI270733v1_random:173698-173720 GTTCCCGCCCCCACGGCGCGGGG - Intergenic
950040808 3:9917964-9917986 GTAGGCGCCAGCACGGGGCCCGG - Exonic
950084719 3:10249114-10249136 ATTCCCGCCACCCCGGGCCCAGG - Intronic
953904224 3:46860447-46860469 GCGCCTACCACCAGGGGGCCTGG + Intronic
954678942 3:52331099-52331121 GTGCCCCCCGCCATGGGGGCAGG - Intronic
957855375 3:85869802-85869824 GTGCCCGCCACCACGGGGCCTGG + Intronic
961512141 3:127409602-127409624 GGGGCAGCCACCACGGGGGCCGG - Intergenic
962793986 3:138834999-138835021 GCCGCCGCCACCGCGGGGCCCGG - Intergenic
964438165 3:156675170-156675192 GTGCCCTCCCCCCCGGGGTCTGG - Exonic
966381159 3:179346912-179346934 GCGCCCGCCACCACCACGCCCGG + Intergenic
968113387 3:196068783-196068805 GTGCCCACCACCACCATGCCTGG - Intronic
968508932 4:986979-987001 GTGACCGCCGCCGCGGGGCGGGG - Exonic
968830468 4:2930977-2930999 GTGCCAGCCCCCTCGGGGACTGG - Intronic
969538881 4:7773573-7773595 CTGCCGGCCACCACCGGCCCAGG - Intronic
969651952 4:8473316-8473338 GTACCCGGCAGCACGGTGCCAGG - Intronic
970289338 4:14554511-14554533 GTGCCCGCCACCACCACACCTGG + Intergenic
977371949 4:96148687-96148709 GTGCCTGCCACCACTGGGCCCGG - Intergenic
985824382 5:2181762-2181784 GTGTCCACCACCCCAGGGCCTGG + Intergenic
986152306 5:5139603-5139625 GTGGCCGTGACCGCGGGGCCAGG + Intergenic
986297220 5:6449313-6449335 CTGGCCCTCACCACGGGGCCCGG - Intronic
986740410 5:10700614-10700636 GTGCTCACCACCACTGTGCCTGG + Intronic
988969894 5:36456806-36456828 GTGCCTGGCGCCACAGGGCCTGG - Intergenic
996347385 5:122501755-122501777 GTCCCCACCACCACAGGCCCCGG - Intergenic
997231918 5:132251585-132251607 GTGCTGGGCACCACGGGGCAGGG + Intronic
998408411 5:141888164-141888186 GGGCCTGCCACCACCGTGCCCGG - Intergenic
1001589192 5:172853830-172853852 GTGCCCACCTCCAAGGGGCCTGG + Intronic
1001920712 5:175597177-175597199 GTGCCTGCTCCCCCGGGGCCTGG + Intergenic
1002166149 5:177347838-177347860 GTGCTCACCACCACTGTGCCTGG - Intronic
1002440111 5:179259837-179259859 GTGTCCTCAACCTCGGGGCCTGG + Intronic
1004518286 6:16339214-16339236 CTGCCAGCCACCAGGGGGCTGGG + Intronic
1006102547 6:31694533-31694555 GTGCCTGCCACCACCATGCCCGG + Intronic
1007381369 6:41492409-41492431 ATGCCATCCATCACGGGGCCGGG - Intergenic
1007414426 6:41683617-41683639 ATGCCCCCCACCCCGGGCCCAGG + Intergenic
1007771798 6:44198306-44198328 GTGCCCGCCACTACCACGCCCGG + Intergenic
1010732858 6:79409518-79409540 GCGCCCGCCACCACCATGCCCGG + Intergenic
1014603640 6:123446437-123446459 GTGCCCACCACCACGCCACCTGG - Intronic
1015122393 6:129713611-129713633 GTGCCCACCACCACGCCACCCGG - Intergenic
1017680525 6:156859257-156859279 GTGCCCGCCACCACGTGTATGGG + Intronic
1018400448 6:163415030-163415052 GTGCCGGCCGCCCCGGGGCTCGG + Exonic
1018753070 6:166824358-166824380 GTGCCGGGCACCAGGGGGACAGG - Intronic
1019055765 6:169222246-169222268 GTGAACTCCACCACGGGGACGGG - Exonic
1019338722 7:497476-497498 GTGACCGCCACCACGGCACCAGG + Intronic
1019417965 7:935807-935829 GTGCCCTCCAGCCCGGGGCATGG - Intronic
1019476646 7:1247606-1247628 GCGCCCCCCACACCGGGGCCCGG - Intergenic
1019599664 7:1874937-1874959 GTGGCCCCCACCCCGGGCCCCGG + Intronic
1020069235 7:5214806-5214828 GTGCCCGGCAACGTGGGGCCAGG - Intronic
1020100016 7:5389254-5389276 GTGGCCGCCGCCAGGGGTCCGGG + Exonic
1023369134 7:39495353-39495375 TTGCCCGCCACAACAGGCCCTGG + Intergenic
1023865069 7:44234604-44234626 CTCCCCGGCACCACAGGGCCCGG + Intronic
1024578846 7:50785495-50785517 GTGCCCGTCACCATGGGCCAGGG - Intronic
1025723128 7:64034392-64034414 GTGCCTGCCACCACCATGCCCGG - Intronic
1025806222 7:64836825-64836847 ATGCCCGCCAGCAGGGTGCCAGG - Intergenic
1027415958 7:77975154-77975176 GCGCCCGCCACCACCATGCCTGG - Intergenic
1027668800 7:81071437-81071459 GTTCCCTGCTCCACGGGGCCGGG + Intergenic
1029318200 7:99733678-99733700 GTGACCTCCACTAGGGGGCCAGG + Intronic
1029323108 7:99782614-99782636 GTGACCTCCACTACGGGGCCAGG + Intronic
1032346340 7:131120023-131120045 GCGCCTGCCAACACGTGGCCTGG - Intronic
1033867679 7:145713031-145713053 GTGACCACCACCACTGGGACTGG + Intergenic
1036471259 8:9054780-9054802 GTGCCTGCCGCCACTGCGCCTGG - Intronic
1039549017 8:38429948-38429970 GCTGCAGCCACCACGGGGCCGGG + Exonic
1039936589 8:42051621-42051643 GGGCCCGCGAGCGCGGGGCCGGG + Intronic
1042204733 8:66317626-66317648 GAGCCCGCCACCATCGTGCCTGG - Intergenic
1043516059 8:80996189-80996211 CTGCCCACGACCACGGGGACTGG - Intronic
1049216735 8:141411747-141411769 GTCCCCGACCCCACGGGCCCTGG + Intronic
1050312574 9:4368488-4368510 GTGCCCACCACCACCACGCCCGG + Intergenic
1050564238 9:6865894-6865916 GCGCCCGCCACCACCATGCCTGG + Intronic
1053163468 9:35829244-35829266 GAGGCCGCCGCCGCGGGGCCTGG + Intronic
1056799265 9:89680126-89680148 GTGGCCACCACCACAGTGCCCGG - Intergenic
1057587274 9:96340472-96340494 GCGCCCGCCACCATGATGCCCGG - Intronic
1060407989 9:123382132-123382154 GTGCCTGCAGCCCCGGGGCCAGG + Exonic
1061880602 9:133567063-133567085 GTACCTGCCACCAGGGGCCCTGG + Intronic
1061934249 9:133848639-133848661 GTGCCTGCCAGCACATGGCCTGG - Intronic
1062386612 9:136314374-136314396 CTTCCCCCCACCACGGGGGCAGG + Intergenic
1062570433 9:137182634-137182656 GTGCCTGCCAGCCCCGGGCCAGG + Intronic
1062574526 9:137200151-137200173 CGCCCCGCCACCGCGGGGCCCGG + Exonic
1203469908 Un_GL000220v1:111767-111789 GTTCCCGCCCCCACGGCGCGGGG - Intergenic
1203477729 Un_GL000220v1:155739-155761 GTTCCCGCCCCCACGGCGCGGGG - Intergenic
1185460336 X:330355-330377 GCGCCCGCCACCACCACGCCCGG - Intergenic
1185491309 X:519196-519218 GCGCCCGCCACCACCACGCCCGG - Intergenic
1185589942 X:1269475-1269497 GTGCCTGCCACCACCATGCCCGG - Intronic
1186427568 X:9475386-9475408 GTGCCCACCACCACCACGCCTGG + Intronic
1190063225 X:47223961-47223983 CTGTCCCCCACCACGGGGCCTGG - Intronic
1190164946 X:48065535-48065557 GTGCCCGCCACCAAGTAGCTGGG - Intronic
1197692981 X:129522935-129522957 GTGCCCGCTCTCCCGGGGCCTGG - Intronic
1199744047 X:150760779-150760801 GCGCCCGCCACCACTGTGTCTGG - Intronic
1200401920 X:156024822-156024844 CTCCCAGCCACCTCGGGGCCAGG - Intergenic