ID: 957857784

View in Genome Browser
Species Human (GRCh38)
Location 3:85900211-85900233
Sequence GTTACTTCATCTAGACTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957857784 Original CRISPR GTTACTTCATCTAGACTAGA AGG Intronic