ID: 957864378

View in Genome Browser
Species Human (GRCh38)
Location 3:86003269-86003291
Sequence CCATGGGGAAAATGGGGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 375}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957864378_957864389 -7 Left 957864378 3:86003269-86003291 CCCATTCCCCATTTTCCCCATGG 0: 1
1: 0
2: 2
3: 35
4: 375
Right 957864389 3:86003285-86003307 CCCATGGGACTTGGGCCATAAGG 0: 1
1: 0
2: 1
3: 17
4: 121
957864378_957864391 -6 Left 957864378 3:86003269-86003291 CCCATTCCCCATTTTCCCCATGG 0: 1
1: 0
2: 2
3: 35
4: 375
Right 957864391 3:86003286-86003308 CCATGGGACTTGGGCCATAAGGG 0: 1
1: 0
2: 1
3: 23
4: 134
957864378_957864392 -5 Left 957864378 3:86003269-86003291 CCCATTCCCCATTTTCCCCATGG 0: 1
1: 0
2: 2
3: 35
4: 375
Right 957864392 3:86003287-86003309 CATGGGACTTGGGCCATAAGGGG 0: 1
1: 0
2: 1
3: 13
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957864378 Original CRISPR CCATGGGGAAAATGGGGAAT GGG (reversed) Intronic
900844529 1:5086155-5086177 TCTTGGGGCAAATGGGAAATGGG - Intergenic
901947483 1:12715479-12715501 GGATGGGGAAGATGGGGGATGGG + Intergenic
902958184 1:19941329-19941351 CCCTGAGGGAAATAGGGAATCGG + Intergenic
903292905 1:22326011-22326033 ACAGGGGGAAAAGGGGGAAAAGG - Intergenic
903332970 1:22606363-22606385 CCATGGGGAGGATGGGGAAGTGG + Intergenic
903946400 1:26966631-26966653 CCATGGGGAAAGCAGGGGATTGG - Intergenic
904047518 1:27617375-27617397 ACATGGGGAAAATGGAGTCTTGG - Intronic
904284560 1:29445580-29445602 CCCTGGGGAACCTGGGGAATCGG + Intergenic
906772306 1:48495945-48495967 ACATGGGGAAGCTGGGTAATAGG + Intergenic
907175566 1:52518799-52518821 GGCTGGGGAAAGTGGGGAATGGG + Intronic
907461326 1:54607430-54607452 CTATGGGTAAAATGAGGGATAGG + Intronic
907680598 1:56559810-56559832 CCATCTGGAAAATGGGGATGAGG + Intronic
908146617 1:61252938-61252960 CCAAGGGAAAAAAAGGGAATTGG + Intronic
908149115 1:61281536-61281558 CCATGGGGATTGTGGGGATTTGG - Intronic
908468664 1:64420320-64420342 ACTTGGTTAAAATGGGGAATGGG + Intergenic
909184032 1:72462326-72462348 ACATGGGGAAAAAGGTGAAATGG - Intergenic
910507122 1:87961929-87961951 TAATGAGGAAAATGAGGAATTGG + Intergenic
911101776 1:94101295-94101317 CAAAGGGGAAAATGAGCAATCGG + Intronic
912005596 1:104896109-104896131 CCAGTGGGAAAAGGGGGAATGGG + Intergenic
912551985 1:110490489-110490511 TCCTGGGAAAAATGGGGAACAGG + Intergenic
913263111 1:117018796-117018818 CTTAGGGGAAAATGGGGAATGGG - Intronic
914349022 1:146823603-146823625 CAATGATGAAAATAGGGAATGGG + Intergenic
915274601 1:154779489-154779511 CCATGGGGAGAGTGGGGATGGGG - Intronic
915448868 1:155990771-155990793 CCTTGGAGAAAATGGGAAAGTGG - Intronic
915818988 1:159001171-159001193 CCATGTGAAAAATGGACAATAGG + Intronic
915903618 1:159862953-159862975 CCCTGGGGGAAGTGGGGAAGAGG + Intronic
915928697 1:160044034-160044056 CCATGGGGAAAATAGAGATGGGG - Intronic
916198782 1:162250181-162250203 CCCTCGGGAAAATGGGCATTTGG - Intronic
916416775 1:164599606-164599628 GCATGGGGATAACTGGGAATGGG + Intronic
916725837 1:167522740-167522762 GGATGGGGAGAGTGGGGAATTGG + Intergenic
917122602 1:171657300-171657322 GCAGGAGGAAAATGGGGACTGGG - Intergenic
918817829 1:189212039-189212061 CCATGGCGAAACTGGGGGATTGG + Intergenic
919854374 1:201695461-201695483 CCAGGGGGAAAAGGGGGTATGGG + Intronic
920226895 1:204445850-204445872 CCCTGGGGAAAATGGTAAAGTGG - Intronic
920296260 1:204958986-204959008 CCATGGTGGAAATGGAGCATGGG - Intronic
920382188 1:205541631-205541653 CCTTGGGGAAAATGGGTCCTTGG - Intergenic
920963258 1:210682415-210682437 CCATGGGGACACTTGGGAAGAGG + Exonic
921696414 1:218215474-218215496 ACATGGGGATTATGGGGATTTGG + Intergenic
921821644 1:219623424-219623446 CCATTAAGAAAATGGGGAAGAGG + Intergenic
923271812 1:232362020-232362042 ACAAGAGGAAGATGGGGAATGGG - Intergenic
923496644 1:234531416-234531438 CCATGGGGAAGAAGGGGAGGTGG - Intergenic
1063388785 10:5634895-5634917 GGATGGGGAAGATGGGGAAGAGG + Intergenic
1063539057 10:6913779-6913801 TAGTGGGGAAAATGGGGAATTGG - Intergenic
1069197841 10:65574689-65574711 TCATGGGAAAAGTGGAGAATGGG - Intergenic
1069657937 10:70104103-70104125 CCCTGGGAAAAATGGAGAAGGGG + Intronic
1069759010 10:70795023-70795045 CCATGAGGAAAATGGCGAACTGG + Intergenic
1072277993 10:93841536-93841558 CCATGGGGAGAGTGGTGAGTAGG + Intergenic
1072641166 10:97212166-97212188 CCATGGGCGAAATGGTGAAGGGG - Intronic
1074408166 10:113199097-113199119 CCATGGGGAAAATGAGGCTGGGG - Intergenic
1074446648 10:113526108-113526130 CCATGGGGAGAAAGGGGACAGGG + Intergenic
1074690647 10:116001350-116001372 CAAAGGGGGAAATGGGGAGTAGG - Intergenic
1075549125 10:123379257-123379279 CCATGAGGAATTTGGGGTATGGG + Intergenic
1077507625 11:2939305-2939327 CCTTGGGGGAAAGGGTGAATAGG - Intergenic
1077549874 11:3195430-3195452 CTCTGGGAAAAATGGGGAAGTGG + Intergenic
1079607197 11:22384775-22384797 CCATCTGGAAAATAAGGAATTGG + Intergenic
1079681655 11:23304579-23304601 CCATCTGGAAAATGTGGAGTCGG - Intergenic
1079795891 11:24802650-24802672 CCCTGGGGGAGATGGGGAATGGG - Intronic
1080932254 11:36823893-36823915 TGATGGGGAGAATGGGGAACAGG + Intergenic
1081774483 11:45667950-45667972 CCGTGGGGAAAAGGGGGAGGGGG + Intergenic
1082945720 11:58756744-58756766 CAATGGGGAAAATATAGAATTGG + Intergenic
1083855159 11:65389636-65389658 CCATGGGGAAAGGTGGGACTTGG + Intronic
1083855994 11:65393400-65393422 CTATGGGTGAAATGGGGGATAGG + Intronic
1084318178 11:68357875-68357897 CCCTGGGGACAAAGGGGAAAGGG - Intronic
1084387661 11:68854459-68854481 GCATTGGAAAAATGGGGAATTGG + Intergenic
1085705111 11:78780017-78780039 CCAAGTGGAAAATTGGGAAGAGG + Intronic
1086318922 11:85624272-85624294 CCATGGTGGGAATTGGGAATGGG - Intronic
1088605436 11:111525866-111525888 TCTTGGGGCAAATGGGAAATGGG + Intronic
1089266492 11:117266706-117266728 CCAGGAGGAAAAAGGGGAATAGG - Intronic
1089697471 11:120225023-120225045 CCATGGGGGAAAGGGGAAGTGGG + Intronic
1090583394 11:128184302-128184324 GCATGGTCACAATGGGGAATGGG + Intergenic
1090666644 11:128918872-128918894 CCTTGGAGGGAATGGGGAATGGG + Exonic
1091686959 12:2569445-2569467 AGATGGGGGAAATGTGGAATGGG - Intronic
1092017321 12:5170104-5170126 CCTTGAGGAAAATGCAGAATCGG + Intergenic
1092214708 12:6672875-6672897 CCATGGGGAACAGGCGGTATTGG - Intronic
1092491763 12:8951840-8951862 TCATGTTGGAAATGGGGAATGGG + Intronic
1092626067 12:10330216-10330238 CCCTGGAAAAATTGGGGAATTGG + Intergenic
1093158290 12:15714697-15714719 TCTTGGGGCAAATGGGAAATGGG + Intronic
1093770218 12:23009478-23009500 CCCTGGGAAAAATGGAGAACTGG + Intergenic
1093866955 12:24238807-24238829 CCATGTGCAAAATGGGAATTAGG - Intergenic
1094696510 12:32824523-32824545 ACATGGGGCAAATTGGGACTTGG - Intronic
1095782684 12:46077908-46077930 GCAGAGGGGAAATGGGGAATTGG - Intergenic
1098384810 12:69907500-69907522 CAAAGGGGAAAATAGGGATTGGG + Intronic
1099018755 12:77377463-77377485 CCATGTGGCATATGGGGAAAAGG + Intergenic
1099062080 12:77924242-77924264 CCATGGGCAAAACGAAGAATAGG + Intronic
1101511067 12:105392680-105392702 CCATGGGAAGCATGGGGAGTGGG + Intronic
1101629489 12:106479174-106479196 GTATGGGGAAAATGAGGAAGAGG - Intronic
1101936360 12:109061180-109061202 TCTTGGGGCAAATGGGAAATGGG + Intronic
1102742204 12:115217816-115217838 GCATGGGAGAAATGGGGGATGGG - Intergenic
1102862167 12:116345397-116345419 CCACGGGCAAAATGGGGGACAGG - Intergenic
1103265510 12:119627006-119627028 TCATGGGGAAACCGGGGAAAAGG + Intronic
1103512412 12:121484320-121484342 ACATGGGAGAAATGGGGAAAAGG + Intronic
1103796706 12:123507999-123508021 CTAGGGGGAATAGGGGGAATGGG + Intronic
1103914243 12:124368362-124368384 CCATGGGGAAACTGAGGCAAGGG - Intronic
1104205097 12:126631465-126631487 CCTAGGGGAAAATGGTGCATGGG + Intergenic
1105209283 13:18248198-18248220 CCGTGGGGCAGATGGGGACTTGG - Intergenic
1107964435 13:45586636-45586658 TCATGTGGAAAATGGAAAATGGG - Intronic
1108701142 13:52945293-52945315 GGATGGGGAAAATGATGAATTGG + Intergenic
1108750846 13:53446940-53446962 CCATGGGGACCATGTGGAAATGG - Intergenic
1108852097 13:54742974-54742996 CTATGATGAAAGTGGGGAATAGG - Intergenic
1108869609 13:54967144-54967166 CCTTGGGGAAAAGTGAGAATGGG - Intergenic
1109274214 13:60286177-60286199 CCATGGTGGGAATGAGGAATAGG + Intergenic
1109378686 13:61528460-61528482 CCACTGGGAAAATGTGGCATAGG - Intergenic
1110209611 13:72956213-72956235 CAATGGAGATAATGGGAAATAGG - Intronic
1110544610 13:76742617-76742639 ACATGGTGAAAATGGGTGATGGG + Intergenic
1110643934 13:77859277-77859299 CCATGGGGAGACTGGAGAAATGG - Intergenic
1110907220 13:80906911-80906933 CCTTTGTGAAAATGTGGAATGGG + Intergenic
1113156266 13:107326484-107326506 AAATGGGGAAAATGGAGAATTGG - Intronic
1113413360 13:110109295-110109317 GAAGGGGGAAAATGGGGAAGAGG - Intergenic
1113518519 13:110921403-110921425 ACATGGGGAAATTAAGGAATCGG - Intergenic
1113642413 13:111967232-111967254 CCATGGTGAAATTGCGGACTCGG + Intergenic
1113645942 13:111996176-111996198 TCATGTGGAAATTTGGGAATGGG - Intergenic
1113645970 13:111996263-111996285 TCATGTGGAAATTTGGGAATGGG - Intergenic
1113856435 13:113448876-113448898 CCCTGGGAAAACTGGGGAAGTGG - Intronic
1113931505 13:113971340-113971362 CCAAGGGGCAGCTGGGGAATGGG + Intergenic
1116093668 14:40340171-40340193 ATATGGGGAAACTGGGGCATGGG + Intergenic
1116368750 14:44103489-44103511 CAATGGGGAAACTGGGCAAAAGG + Intergenic
1118629824 14:67692546-67692568 GGATGTGGAAAAGGGGGAATTGG - Exonic
1121303250 14:92888663-92888685 CCATGGGGATACTGAGGAGTTGG + Intergenic
1121550443 14:94795661-94795683 AGATGTGGAAGATGGGGAATGGG + Intergenic
1121930426 14:97966989-97967011 CTGTAGGGAAAATGGGGAGTAGG - Intronic
1123025454 14:105421659-105421681 CCATGGGGAAACCGAGGCATGGG - Intronic
1125536687 15:40444764-40444786 CCATGGGGGAAACGGGAAAGAGG + Intronic
1127965429 15:63919420-63919442 GAATGGGGAAAATTGGGAAAAGG - Intronic
1128577304 15:68784796-68784818 CCATCTGGAAAATGGGGGGTTGG + Intronic
1129515279 15:76153532-76153554 CATTGGGGAGAATGTGGAATTGG + Intronic
1129654929 15:77517740-77517762 TCATGGGGCAAATGGGCACTGGG + Intergenic
1129751267 15:78066187-78066209 CCTTGGGGCCAATGGAGAATTGG + Intronic
1129773535 15:78218132-78218154 CCATTTGTAAAATGGGGAAAGGG + Intronic
1130068435 15:80626453-80626475 ACATGGGGAAACTGAGGATTAGG + Intergenic
1130915767 15:88303350-88303372 CCATGGAGAAAGTGGAGAACTGG - Intergenic
1132038580 15:98506085-98506107 CCATGGGGGAGATGTGGGATGGG - Intronic
1133257445 16:4525851-4525873 CCATCAGGACAATGGGAAATGGG - Intronic
1134329492 16:13237298-13237320 CCATCTGAAACATGGGGAATTGG + Exonic
1134473461 16:14549312-14549334 GAATAGGGAATATGGGGAATAGG - Intronic
1136008782 16:27348836-27348858 CCCAGGGGAAACTGGGGAAGAGG + Intronic
1137521931 16:49202008-49202030 TCTTGGGGAACATGGGGAAGAGG - Intergenic
1137733796 16:50709566-50709588 GCATGGGGAGGATGGGGAAGTGG + Intronic
1138301173 16:55931027-55931049 CCATATGGAAAATGGGGTTTTGG - Intronic
1138527594 16:57617999-57618021 CCATGGGGAAGAGGGGCAAGAGG + Intronic
1139118564 16:63987120-63987142 TCATGGGGAAAATGGTGCAGTGG - Intergenic
1139230947 16:65281714-65281736 CCAGGGGGAGAATAGGCAATTGG - Intergenic
1139917444 16:70437449-70437471 CCACTGGGAAACTGGGGATTGGG + Intronic
1139985011 16:70891952-70891974 CAATGATGAAAATAGGGAATGGG - Intronic
1143451742 17:7040851-7040873 CCACAGGGATAATGGGGAAGAGG - Intergenic
1143565873 17:7720233-7720255 CCAGGGTGAAAATGGGAAAAAGG - Intronic
1143785281 17:9251047-9251069 CCATGTGGAGAATGGAGAAATGG - Intronic
1145403792 17:22569068-22569090 CCATGGGGGAAGTGGGGGACAGG - Intergenic
1145813853 17:27781534-27781556 GCAGGGGGAAGATGGGGTATGGG - Intronic
1147325574 17:39667985-39668007 CGAGGGGGAAACTGGGGAAAGGG + Intronic
1147398786 17:40166158-40166180 CAATAGGCAAAATGGGTAATAGG - Intronic
1147476264 17:40714532-40714554 CTAGGGAGAAGATGGGGAATGGG + Intergenic
1150159033 17:62878613-62878635 CCATGAGTAAACAGGGGAATTGG - Intergenic
1150905826 17:69336123-69336145 CCATGGGAAAAAAGGGAAAATGG - Intergenic
1151309125 17:73282691-73282713 CCATCTGGAAAATGGGGATGTGG + Intergenic
1151393531 17:73803952-73803974 CCAGAGGGCCAATGGGGAATGGG - Intergenic
1152592855 17:81222384-81222406 CCCTGGGGAAAATGGGGAGATGG - Intronic
1152607414 17:81299705-81299727 CCATGGGGAAGTTAGGGAAAGGG - Intergenic
1152620118 17:81359182-81359204 CATTGGGGGAAATGGGGAAAAGG - Intergenic
1153132596 18:1873742-1873764 CCATGTGGAAAATGAGAAACAGG + Intergenic
1153261462 18:3228136-3228158 CCTTTGGGAACATGGGGATTGGG - Intergenic
1153681347 18:7503975-7503997 CCCTGAGGATAAGGGGGAATGGG + Intergenic
1155309995 18:24514107-24514129 GCATGAGGAAAATGGGAAGTGGG - Intergenic
1155424144 18:25688514-25688536 TCATTGGGAAAATGGAAAATGGG - Intergenic
1155465383 18:26128954-26128976 ACATGGTGAAAATGTGTAATGGG + Intergenic
1159201978 18:65198316-65198338 ACCTAGGGAAAATGGGGAAAGGG - Intergenic
1159683931 18:71392767-71392789 TCTTGGGGCAAATGGGAAATGGG + Intergenic
1159695937 18:71556523-71556545 CCATGGGAAGAATGGGGAGAAGG + Intergenic
1160040384 18:75339771-75339793 CCGTGGGAGAAATGCGGAATGGG - Intergenic
1160385054 18:78491818-78491840 CCATGGGGAAAATTGGGTAAAGG + Intergenic
1161275670 19:3415495-3415517 CAATGGGTGAAATGGGGCATGGG - Intronic
1161717784 19:5886559-5886581 CTATGGGGAAACTGAGGCATAGG - Intronic
1162189641 19:8934691-8934713 CACTAGGGAGAATGGGGAATGGG + Intronic
1162485909 19:10960643-10960665 CGATGGGGCAACTGGAGAATGGG - Intergenic
1163362633 19:16856946-16856968 CCCTGGGGTAAATGGGAAAAGGG - Intronic
1163742841 19:19026977-19026999 CCATGTAGAAAAGGGGAAATGGG + Intronic
1164475468 19:28572543-28572565 CCATGGGGAAAATGGGGGACTGG + Intergenic
1165694765 19:37892526-37892548 GGAGGGGGAAAATGGCGAATGGG + Intronic
1166346216 19:42167789-42167811 CCATAGGCAATATGGGCAATGGG - Intronic
1167399568 19:49255883-49255905 CCTAGGGGAAAATGGGGACAGGG - Intergenic
925158189 2:1662892-1662914 TCATGGGGACCATGGGGAGTGGG - Intronic
926552376 2:14316079-14316101 CCTTGGGGAGAATGGGGAACAGG - Intergenic
926625882 2:15089420-15089442 CCATTTGTAAAATGAGGAATTGG - Intergenic
926877354 2:17496246-17496268 CTATGGGGAAAGGGGGGAAGAGG - Intergenic
927188301 2:20498055-20498077 CCCTGGGGAAAATGGGACAAGGG - Intergenic
927268809 2:21183497-21183519 CCTTGGGGAAAATTAGGAAGAGG + Intergenic
928447252 2:31344376-31344398 CCATGAGGAAACAGGGGAACAGG + Intronic
928794115 2:34995888-34995910 TCTTGGGGCAAATGGGAAATGGG - Intergenic
928926560 2:36585769-36585791 ACATTGGGAAGATGGGGAAAGGG + Intronic
929352402 2:40973570-40973592 CCATAGGGGAAGTGGGAAATTGG + Intergenic
929452272 2:42046128-42046150 CCCTGGGGAAAACGGGGAGCTGG - Intergenic
929618091 2:43328103-43328125 CCATGGTAAAAATTGGAAATCGG - Intronic
930158705 2:48131123-48131145 CCATGGGGTAGATGGCTAATGGG + Intergenic
930223598 2:48769430-48769452 CAATGGGGAAAAGGAGGAATCGG + Intronic
930695040 2:54402600-54402622 CCATGGGGAGAAGGGAGAAAGGG + Intergenic
931147663 2:59537108-59537130 CAATGGGGAAAATGTGGCAAAGG - Intergenic
931309183 2:61062614-61062636 ACTTGGTGAAAAGGGGGAATTGG + Intergenic
931789965 2:65656126-65656148 CAATTAGGAAAATGGGGAGTGGG + Intergenic
932332543 2:70905914-70905936 CCAAGGGGTAATTGGGGAAATGG - Intronic
932855799 2:75232811-75232833 CCTTGGGGAAAAAAGGAAATGGG + Intergenic
935128840 2:100246317-100246339 CAAGGGGGAAAATGAGGAAATGG - Intergenic
936528786 2:113260575-113260597 GGATGGGGAGAAGGGGGAATAGG + Intronic
938221905 2:129576085-129576107 CAATGTGGAAAATGGGGAAGTGG - Intergenic
938705220 2:133918295-133918317 CCATCTGTAAAATGGGGATTAGG - Intergenic
939222262 2:139317425-139317447 CGGTGGGGATAATGGAGAATAGG + Intergenic
940796941 2:158090011-158090033 TCTTGGGGAAAATGGAGGATAGG - Intronic
942296576 2:174523453-174523475 AGATGGGGAAAATGGGGAAGAGG - Intergenic
943567247 2:189530489-189530511 CAATTGGGAGAATGGGGGATGGG + Intergenic
945628555 2:212240980-212241002 CCATGGAGAAAATTGGTGATGGG + Intronic
946014380 2:216592173-216592195 CAATGTGGGAAATGGGGAAAAGG + Intergenic
946260446 2:218486025-218486047 CCATGGGGAAAAGGCTGAAAAGG - Intronic
946285786 2:218701472-218701494 CCATGGGGAAAATAATTAATGGG + Intronic
946503514 2:220275134-220275156 ACATAGGGAAAATGTGTAATTGG - Intergenic
946762743 2:223011189-223011211 CTATGGGGAAACTTGGGATTTGG + Intergenic
946817942 2:223598280-223598302 GAATGGGCAAAATGGGGAAAGGG - Exonic
947352452 2:229260651-229260673 TCATGGGTAGAATTGGGAATTGG + Intronic
948388935 2:237598319-237598341 GGATGGGGAAAATGGAGAAGGGG - Intronic
948542074 2:238698173-238698195 CAAAGAGGAAAACGGGGAATAGG - Intergenic
1168856223 20:1011109-1011131 GCCTGGGGAAGATGGGCAATTGG - Intergenic
1170264085 20:14445505-14445527 CAACCAGGAAAATGGGGAATTGG - Intronic
1170827542 20:19809410-19809432 CCATGTGGAGGATGGGGACTTGG + Intergenic
1170878145 20:20270275-20270297 CCATGGAGAGAATCGGGACTTGG - Intronic
1171290452 20:23979911-23979933 CCGTGGGGCAGATGGGGACTTGG - Intergenic
1171527395 20:25825576-25825598 CCATGGAAAAAATAGGGAAGTGG + Intronic
1171549431 20:26030308-26030330 CCATGGAAAAAATAGGGAAGTGG - Intergenic
1172241833 20:33418160-33418182 CCATGGGGAAAATGAGAGAAGGG - Intronic
1172588941 20:36104293-36104315 CCCTGTGGAGAATGGGGAAGTGG + Intronic
1173544597 20:43885192-43885214 TCAGGGGGAAAATGGGGCAGAGG + Intergenic
1173746567 20:45441897-45441919 CCATGATGGAAAGGGGGAATTGG + Intergenic
1173964909 20:47105294-47105316 CCATGTAGAAAATGGGGAGATGG - Intronic
1174017482 20:47500573-47500595 CCATGGGGAGATTAGGGAATGGG + Intergenic
1175501116 20:59451749-59451771 CCCTGGGGCAGCTGGGGAATGGG + Intergenic
1175515456 20:59567207-59567229 CCCTGGGGAACATGGAGAAGGGG - Intergenic
1176649376 21:9531086-9531108 CCATGGGGGAAGTGGGAAACAGG + Intergenic
1176694835 21:9962886-9962908 CCATGGGGAATATTGGAATTGGG - Intergenic
1178400827 21:32283379-32283401 AGATGGGGAAAGTGGGGGATAGG - Intergenic
1180200795 21:46222887-46222909 CCATGGGGAACTTTGGGAACAGG + Intronic
1180766976 22:18351099-18351121 CCGTGGGGCAGATGGGGACTTGG + Intergenic
1180779337 22:18511280-18511302 CCGTGGGGCAGATGGGGACTTGG - Intergenic
1180812054 22:18768600-18768622 CCGTGGGGCAGATGGGGACTTGG - Intergenic
1181198209 22:21202844-21202866 CCGTGGGGCAGATGGGGACTTGG - Intergenic
1181401535 22:22652960-22652982 CCGTGGGGCAGATGGGGACTTGG + Intergenic
1181703496 22:24634057-24634079 CCGTGGGGCAGATGGGGACTTGG + Intergenic
1182189204 22:28442183-28442205 TCATGGGGAAAAGGGGGAGGGGG - Intronic
1182622411 22:31625402-31625424 CCATGGGCAGGAAGGGGAATGGG + Intronic
1182722885 22:32417944-32417966 CCATTGTGAAAATGGACAATGGG + Intronic
1183006187 22:34904754-34904776 CTATGGAGAAAATGGGGATTAGG - Intergenic
1184864809 22:47196198-47196220 CCTTGGGGACAAGTGGGAATGGG + Intergenic
1203228598 22_KI270731v1_random:91993-92015 CCGTGGGGCAGATGGGGACTTGG + Intergenic
949930000 3:9071175-9071197 CCTTGGGGAGAATGAGGAAGTGG - Intronic
950627812 3:14260908-14260930 CCATGGGAAAGATGGTGAGTTGG + Intergenic
950936868 3:16847975-16847997 CCATGGGGGAACTCTGGAATTGG + Intronic
951459638 3:22936532-22936554 CCATTGGTAAAATGAGGATTGGG + Intergenic
951978023 3:28535611-28535633 ACATGGGGAAAGTTGGGAATAGG + Intronic
953597996 3:44336361-44336383 CCATGAGGAAAATGGAGGACTGG + Intergenic
954566220 3:51602292-51602314 TCATGGGGAAAAAATGGAATAGG + Intronic
954614458 3:51962475-51962497 CTATGGGGAAAACAGGGAGTGGG + Intronic
954673542 3:52303443-52303465 TCATGGGGAAAGTGGGGCTTAGG + Intergenic
954751642 3:52817390-52817412 CCAAGGGTAAGATGGAGAATTGG + Intronic
957792636 3:84959707-84959729 GAATGGGGAAGATGGGGAATGGG - Intronic
957864378 3:86003269-86003291 CCATGGGGAAAATGGGGAATGGG - Intronic
958506752 3:94988621-94988643 CCATGGGGAAAATTGGAACATGG + Intergenic
959016641 3:101142228-101142250 CCATGAGCAAAATGGGCAAGAGG + Intergenic
959305938 3:104666131-104666153 ACAAGGGGGAAATGGGAAATAGG + Intergenic
960701653 3:120445469-120445491 CCATGAAGAAAATGAGGGATAGG - Intronic
961821515 3:129577863-129577885 CCATCTGGACAATGGGGAATGGG + Intronic
962342345 3:134596169-134596191 CCATGGGGAAAATTTGGAGCGGG + Intergenic
962412494 3:135153382-135153404 CCATGTGAAAAATGTTGAATTGG + Intronic
962544297 3:136416532-136416554 CCCTGGAGAAAATGGAGAAAAGG + Intronic
962760445 3:138508159-138508181 ACATGGGGAAAGTAGGGAAAAGG + Intronic
963073900 3:141328861-141328883 ACATGGGAAAAATTGGGAAAGGG - Intronic
963555029 3:146776395-146776417 CTCAGGGGAAAATGGGGAACTGG - Intergenic
964503940 3:157377983-157378005 CCATAGGGAAAATAGAGAATAGG + Intronic
966005286 3:175003814-175003836 ACATGGTGAAAATGTGTAATGGG + Intronic
968185984 3:196633939-196633961 CCTTGGGGAAAATGGGCACGCGG - Intergenic
968757205 4:2423043-2423065 CCCTGGCGAAGATGGGGAGTGGG + Intronic
969165629 4:5308392-5308414 ACTTGGGGAAAATGGTGGATAGG - Intronic
969392200 4:6899155-6899177 CCATCTGGAAAATGAGGAGTTGG + Intergenic
971342684 4:25785100-25785122 CCATGTGGCACATGGGGATTGGG - Intronic
971431934 4:26577473-26577495 TCCTGGGGAAAATTGGAAATGGG + Intronic
971873491 4:32274318-32274340 CCAGGGGGATAATGCAGAATGGG + Intergenic
972182355 4:36484274-36484296 TCATGGGGAATATGGTAAATTGG - Intergenic
973822279 4:54672647-54672669 CCATCAGAAAAATGGGGAATAGG - Intronic
976014495 4:80535283-80535305 CCATTGGGAAAATGAGGGAAGGG - Intronic
976436257 4:85022080-85022102 CGATGGGGAAAATGGAGAGAGGG + Intergenic
976564825 4:86541180-86541202 TTATGGGGAAAGTGGGGAGTGGG + Intronic
977453127 4:97224093-97224115 ACATGGGGATATTGGAGAATTGG + Intronic
978445627 4:108777486-108777508 ACATGGGGACATTAGGGAATGGG + Intergenic
978582572 4:110246981-110247003 ACATGGGAAAAATGTGGGATGGG - Intergenic
979090889 4:116480686-116480708 CCATGGGGAAAATGGAACACTGG + Intergenic
980264250 4:130494608-130494630 CCTTGGGCCAAATGGGAAATAGG - Intergenic
980569840 4:134600287-134600309 GCATGGGGAAAATGGAACATTGG + Intergenic
983145637 4:164211054-164211076 ACATGGGGAGTATGGGGAAAGGG + Intronic
985420026 4:189775963-189775985 CCATAGGAAAAATGGGGCACTGG - Intergenic
985491837 5:184647-184669 CCTTGGGGCAAATGGGAGATGGG - Exonic
986234092 5:5891870-5891892 CCATGGGAAACATCGGGAAGTGG - Intergenic
987460885 5:18208340-18208362 CCATAAGTAAAATGGGTAATGGG + Intergenic
987847696 5:23307422-23307444 CTATGGGGAAAATGGAGCACAGG + Intergenic
988644732 5:33082084-33082106 ACATGGGGAAAATGGTAAATGGG + Intergenic
989111728 5:37913304-37913326 CCATGGGAACAAAGGGGAAGGGG + Intergenic
989481498 5:41935807-41935829 CCATGGGGGTTATGGGGAAGAGG - Intronic
990014232 5:51039454-51039476 CAATGGGGAAAGTGGGGAGGGGG - Intergenic
990852105 5:60217245-60217267 CAATGGGGACAAGGAGGAATGGG + Intronic
991449719 5:66739177-66739199 TCATTGTGAAAATGGGGAAATGG + Intronic
991570505 5:68048658-68048680 CACTGGAGAAAATGGGGAAGAGG + Intergenic
992696187 5:79289923-79289945 GAAAGGGCAAAATGGGGAATAGG + Intronic
992928218 5:81613795-81613817 CCATGAAGAATATGAGGAATTGG - Intronic
993016891 5:82544561-82544583 CCAAGGGGAAAATGCGGGGTTGG + Intergenic
994347152 5:98700515-98700537 TGAAGGGGAAAATGGTGAATAGG + Intergenic
994836539 5:104862184-104862206 ACATGGTGAAAATGTGTAATGGG - Intergenic
996117683 5:119635470-119635492 CCTTGGGGAAAAGGGGAATTTGG + Intronic
997712353 5:136016337-136016359 ACTTGTGGAAAATGGGGACTTGG - Intergenic
998794176 5:145799900-145799922 CTATGGTGAAAATGGGGAATAGG - Intronic
999295474 5:150457046-150457068 CCAGGGGGCAGATGGAGAATGGG + Intergenic
999300557 5:150487602-150487624 CGGTGGGGAAAATGGGGAAGAGG - Intronic
1000441437 5:161268779-161268801 GCAAGGGTAAAATGGGGAATTGG - Intergenic
1001431361 5:171665148-171665170 CCATGGGGAACAATTGGAATTGG - Intergenic
1002885383 6:1289349-1289371 CCAAGGGGGACATGGGGGATTGG + Intergenic
1003761043 6:9179058-9179080 GCAAGGGGAATTTGGGGAATAGG + Intergenic
1004178930 6:13364641-13364663 CCATGGGGAATGTGGGGATCAGG - Exonic
1005159471 6:22842493-22842515 CCATGTGTAAAATCGAGAATTGG - Intergenic
1006084269 6:31585413-31585435 GCATGGGGAACATGGAGGATGGG + Intergenic
1008190865 6:48454968-48454990 TGATGGGGAAAATGAGGAAATGG + Intergenic
1010802974 6:80199414-80199436 CCATGGGGAAAATGAACAAAAGG + Intronic
1012331916 6:98001962-98001984 CGATGAGGAAAGTGGGGATTGGG + Intergenic
1012465535 6:99513204-99513226 ACATGGAGAAAATGGTTAATTGG - Intronic
1012530609 6:100231049-100231071 CTATAGGGAAAGTGAGGAATGGG - Intergenic
1012714943 6:102656758-102656780 CAATGTGGAATATGGAGAATGGG - Intergenic
1012917327 6:105184473-105184495 CCCAGGGGAGAAAGGGGAATTGG - Intergenic
1013068905 6:106710470-106710492 CCATGCTGAAAATGGGGATTAGG - Intergenic
1013312369 6:108907985-108908007 CCAGGAGGAAAATAGGAAATGGG - Intronic
1016525141 6:144993102-144993124 TCCTGGGGAAAATGGGGAAATGG - Intergenic
1017599484 6:156064872-156064894 AGTTGGGGAAACTGGGGAATCGG + Intergenic
1018370736 6:163165557-163165579 TCAGGGGGAAAAAGGGGAAATGG + Intronic
1020092655 7:5350110-5350132 CCATGGGGGAGATGGGGGAAAGG + Intronic
1020130585 7:5556601-5556623 CCATGGGGGGAAGGGGGTATCGG + Intronic
1022205867 7:28163182-28163204 CCATGTGCAAACTGAGGAATAGG - Intronic
1022544873 7:31176855-31176877 CAATGGGGAAAATTGGGTGTGGG + Intergenic
1022935693 7:35173863-35173885 ACATGGAGAAAATGGAGAGTTGG - Intergenic
1024525977 7:50349673-50349695 GCATGGGGGTGATGGGGAATGGG + Intronic
1027170218 7:75866568-75866590 ACCTGGGGAAATTGGGGCATTGG + Intronic
1028551141 7:92067618-92067640 CTATGAGGAAAATGGGCAGTTGG - Intronic
1029258094 7:99283089-99283111 CCAGGGGGCATATGGGAAATAGG - Intergenic
1029695243 7:102208718-102208740 CCATGGGAAGAACAGGGAATCGG - Intronic
1029993999 7:104988908-104988930 ACATGAGTAAAATGAGGAATTGG - Intergenic
1030543480 7:110862984-110863006 CCCTGTGGAAACTGGGGGATCGG + Intronic
1032713432 7:134483204-134483226 CAATGGGGACACTGGGGAGTGGG + Intergenic
1033357707 7:140613899-140613921 CCATGGGAAAAGAAGGGAATGGG - Intronic
1034374171 7:150628442-150628464 TCATGGGGAAAACAGGGAGTGGG - Exonic
1034396214 7:150826718-150826740 CCATGAGGAAAATGGGGATATGG + Intronic
1037829099 8:22177691-22177713 CCAAGGGGAGCCTGGGGAATGGG - Intronic
1037914871 8:22766936-22766958 CCATGAGGAAACTGAGGCATGGG - Intronic
1038642296 8:29338148-29338170 CAATGAGGAAGAGGGGGAATGGG + Intronic
1038667355 8:29550638-29550660 CCAGGAGGAAACTGGGGAGTAGG - Intergenic
1038981660 8:32766030-32766052 CCATGGGACAAATGGGAAACAGG + Intergenic
1039178785 8:34839891-34839913 TCATGGGGAAAAGGATGAATGGG - Intergenic
1039741424 8:40386497-40386519 TCATCTGGAAAATGGAGAATGGG + Intergenic
1041257355 8:55990762-55990784 CCATGATGAGAAGGGGGAATTGG - Intronic
1043934776 8:86130796-86130818 CCATAGGGCACATGGGGAAGAGG - Intronic
1044312434 8:90709208-90709230 CCATGGGAAAAGTGTGGTATTGG + Intronic
1047988243 8:130258949-130258971 CGATGGGGCAAATAGGGAAAAGG - Intronic
1048870885 8:138796818-138796840 CCAAGGGGAAAAGGGTGAAAAGG - Exonic
1049018252 8:139936692-139936714 GCATGGGGAGAGTGGGGAGTGGG + Intronic
1049412263 8:142478574-142478596 CCATGAGGAGAGTGGGGCATGGG + Intronic
1050655169 9:7820070-7820092 GGATGGGGAAAGTGGAGAATTGG + Intronic
1053343407 9:37359541-37359563 CCATGGAGAAAATGGGAGACTGG - Intergenic
1053584201 9:39438975-39438997 TCTTGGGGCAAATGGGAAATGGG - Intergenic
1053631806 9:39948827-39948849 CCATGGGGAATATTGGAATTGGG - Intergenic
1053773954 9:41514702-41514724 CCATGGGGAATATTGGAATTGGG + Intergenic
1054105781 9:60997721-60997743 TCTTGGGGCAAATGGGAAATGGG - Intergenic
1054212081 9:62301871-62301893 CCATGGGGAATATTGGAATTGGG + Intergenic
1054312903 9:63546959-63546981 CCATGGGGAATATTGGAATTGGG - Intergenic
1056052622 9:82785321-82785343 CCACAGGGAAAATGTGGAAAAGG - Intergenic
1056648731 9:88438835-88438857 ACATGGGGAAAATGTGTGATGGG + Intronic
1057079765 9:92164407-92164429 CCATAGGGTAACTGGGGACTGGG - Intergenic
1057267361 9:93627799-93627821 TCTTGGGGAGGATGGGGAATTGG + Intronic
1058251669 9:102705621-102705643 CCATTGTGAAAATGGGCAAAAGG - Intergenic
1058385996 9:104436658-104436680 CAAAGGGGAAAAAGGGCAATGGG - Intergenic
1058445883 9:105054433-105054455 CTCTGGGCAAAATGGGGAAGTGG - Intergenic
1058570718 9:106340035-106340057 CCATGTGGAAAATGGCAGATTGG - Intergenic
1059058433 9:111008933-111008955 ACATTGGGAGAATGGGGAGTGGG + Intronic
1203627117 Un_KI270750v1:34634-34656 CCATGGGGGAAGTGGGAAACAGG + Intergenic
1186318535 X:8398187-8398209 CCATGGGGTAGTTGGGGAATGGG - Intergenic
1186330894 X:8532757-8532779 GCATGGAGAAAATGAAGAATAGG - Exonic
1186540551 X:10395831-10395853 CAAAGGGGAAAATGAGGAAGTGG - Intergenic
1186623251 X:11263827-11263849 AGATGAGGAAAATGGGGCATGGG - Intronic
1186817421 X:13251689-13251711 CCATGGGGAAATTGGGTAAGGGG - Intergenic
1187776755 X:22768872-22768894 GAAGGGGGAAATTGGGGAATGGG + Intergenic
1188952618 X:36394965-36394987 CCAGGGGTAAAATAGGGGATTGG - Intergenic
1191847024 X:65554648-65554670 CCCTGGGGAAAAAGGCGAATGGG - Intergenic
1191902556 X:66054950-66054972 CCATGGGGACTAAGGGGAAAGGG + Intergenic
1192140565 X:68644283-68644305 CCATGGGGTATATGGGGAAGAGG + Intergenic
1192860375 X:75062180-75062202 CCATATGGAAAAAGGGGGATAGG + Intronic
1193682360 X:84538379-84538401 CTATGAGGAGAAGGGGGAATTGG - Intergenic
1193850510 X:86531698-86531720 GCAGAGGGAAAATGTGGAATTGG + Intronic
1194771474 X:97911937-97911959 TCATGGGGAAAGTAGGTAATGGG + Intergenic
1194869376 X:99109265-99109287 CCATAGGGAAAGTGGGCAAAAGG + Intergenic
1194884989 X:99303459-99303481 ACATTGAGTAAATGGGGAATGGG - Intergenic
1195071130 X:101281210-101281232 AAATGGGGAAAATGGCGAAAGGG + Intronic
1195477039 X:105298995-105299017 AGATGGGGAAAATGAGGAAAAGG + Intronic
1195661797 X:107386006-107386028 CCATTTGGAAACTGGGGAAGAGG - Intergenic
1195952409 X:110289196-110289218 ACATGTGGATAATGGGGAGTTGG - Intronic
1196316295 X:114228626-114228648 CTATGGGGATAATGGGAATTTGG + Intergenic
1196668494 X:118341682-118341704 TTATGGGGAAAATGGGGTAGGGG + Intergenic
1196910720 X:120481901-120481923 TCCTCAGGAAAATGGGGAATTGG + Intergenic
1197197826 X:123720907-123720929 GGAAGGGGAAAATGGGGAGTTGG + Intronic
1197726995 X:129783027-129783049 CCATGGAGAAAGTGGGGATGTGG - Intronic
1199069976 X:143464563-143464585 CCCTGGGAAAATTGGGGAGTAGG + Intergenic
1199757682 X:150880538-150880560 CCAGGGGGAAGGTGGGAAATGGG + Intronic
1199795141 X:151188074-151188096 CCATGGGGAAGAAGGGGATGGGG - Intergenic
1200282493 X:154789621-154789643 CCAAGAGGAAAATGGGTAAAGGG - Intronic
1200381328 X:155840462-155840484 GGTTGGGGAAAAGGGGGAATAGG + Intergenic
1201052573 Y:9952862-9952884 ACACTGGGAAAATGGGTAATTGG - Intergenic
1201432351 Y:13916040-13916062 ACATGGAGAAAATGAAGAATAGG + Intergenic