ID: 957866436

View in Genome Browser
Species Human (GRCh38)
Location 3:86029919-86029941
Sequence AGTTTGGTGTGGAGCCCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957866431_957866436 26 Left 957866431 3:86029870-86029892 CCACAGTCAAGGATAAAATTGTC 0: 1
1: 0
2: 0
3: 20
4: 299
Right 957866436 3:86029919-86029941 AGTTTGGTGTGGAGCCCTTGAGG 0: 1
1: 0
2: 0
3: 15
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957866436 Original CRISPR AGTTTGGTGTGGAGCCCTTG AGG Intronic
901765442 1:11496963-11496985 AGTCTGGTGTGATGCCCTTGTGG + Intronic
904799300 1:33081503-33081525 AGTTTGGTAAGGGGCCCTGGGGG + Exonic
905301769 1:36990528-36990550 AGTCTGGGGTGGAGCCCTTCAGG - Intronic
906044243 1:42816202-42816224 AGTCTGGTGCGGAGCTTTTGTGG - Intronic
910111659 1:83690010-83690032 AGTTTGTTTTCTAGCCCTTGTGG + Intergenic
915061740 1:153191700-153191722 AGTGTGGTGTGGGAACCTTGGGG - Intergenic
915778914 1:158523636-158523658 GATGTGCTGTGGAGCCCTTGTGG + Intergenic
916618213 1:166467267-166467289 AGTTTTGGGTGAAGCACTTGGGG + Intergenic
916732938 1:167582552-167582574 TGTTTGGTGGGAAGCCCTGGAGG - Intergenic
924251861 1:242140962-242140984 GGTCAGCTGTGGAGCCCTTGTGG + Intronic
1062801203 10:381850-381872 GGTGTGGTGTGGGGCTCTTGGGG - Intronic
1065522498 10:26586217-26586239 AGTTCAGTGTGGACCCCATGGGG - Intergenic
1066981733 10:42422849-42422871 AGTTTGATGGGAAGCTCTTGGGG - Intergenic
1070089690 10:73272100-73272122 ACTTTGGGGTGGATCACTTGAGG + Intronic
1070664447 10:78333302-78333324 AGCTGTGTGTGGAGCCCATGAGG + Intergenic
1074782374 10:116811315-116811337 AATTGGATGTGAAGCCCTTGAGG - Intergenic
1075475077 10:122727460-122727482 GGTTTGGGGTGGGGCCCGTGAGG + Intergenic
1076384592 10:130047225-130047247 AGCCTGGTGTGGACCCCATGGGG + Intergenic
1077013545 11:390433-390455 AATTTGGTGAGGAACACTTGGGG + Intergenic
1083894091 11:65611580-65611602 AGCTTGGGGTGGAGGACTTGCGG - Intronic
1084505464 11:69564092-69564114 AGTCTGTGGTGGGGCCCTTGTGG + Intergenic
1084878541 11:72152763-72152785 ACTTTAGGGTGGAGCCCTTGGGG + Intergenic
1090070818 11:123543430-123543452 ACATTGGTGTGGACACCTTGGGG + Intronic
1091632963 12:2176263-2176285 ATGCTGGTGTGGAGCCCGTGTGG + Intronic
1092591968 12:9960383-9960405 AATTTGGAGTGGATCCCTTGGGG - Intronic
1093967258 12:25340659-25340681 AGTTTGCTGTGGGGCGTTTGGGG - Intergenic
1094059919 12:26302631-26302653 AGGTTGTAGTGGAGCCATTGTGG - Intergenic
1094169295 12:27475220-27475242 AGTATGTTGTTAAGCCCTTGTGG + Intronic
1098558441 12:71845578-71845600 ATTTGGGTGTGGAGCCCATTAGG + Intronic
1099219657 12:79897985-79898007 AGTTTAGTGTGAAGTCATTGAGG - Intronic
1100648493 12:96558389-96558411 AGTTTTTTGTGGAGTCTTTGGGG - Intronic
1101858321 12:108462742-108462764 AGGATGGTGTGGAGGCCTTTGGG - Intergenic
1104085268 12:125468969-125468991 AATTTTGTGTGGAATCCTTGGGG + Intronic
1107308690 13:39052472-39052494 AGTTTTGTGTGGAGCGTATGGGG + Intergenic
1116852240 14:49919964-49919986 AGTTTGGTGTGGAGCAATTAGGG - Intergenic
1117654813 14:57944069-57944091 AAATTGGTGTGGAGCTCGTGTGG - Intronic
1119932581 14:78562554-78562576 AGTGTGGTGGAGAGGCCTTGGGG + Intronic
1121882789 14:97515431-97515453 ATTTTCCTGTGGAGGCCTTGAGG - Intergenic
1122289708 14:100673866-100673888 AGGTTGGGGTGGAGGCCTGGAGG - Intergenic
1123934937 15:25189558-25189580 ATTTTGGGCTGGAGTCCTTGAGG + Intergenic
1123935380 15:25191560-25191582 ATTTTGGGCTGGAGACCTTGAGG + Intergenic
1123937160 15:25199597-25199619 ATTTTGGGCTGGAGCCCTGGAGG + Intergenic
1123939937 15:25211940-25211962 ATTTTGGGCTGGAGCCCTGGAGG + Intergenic
1123940784 15:25215685-25215707 ATTTTGGGCTGGAGACCTTGAGG + Intergenic
1123943350 15:25227253-25227275 ATTTTGGGCTGGAGACCTTGAGG + Intergenic
1123944168 15:25230982-25231004 AGTTTGGGTTGGAGGCCTGGAGG + Intergenic
1124869615 15:33527720-33527742 AGTATGGTGGGAAGCCATTGTGG + Intronic
1128678064 15:69626313-69626335 GGTTGGGTGAGGAGCCCTGGAGG - Intergenic
1134822790 16:17260234-17260256 AGTTTGGGGTCCAGCCCTTCTGG - Intronic
1138305194 16:55968225-55968247 AGTTGGGTGTGGAGCTTCTGAGG - Intergenic
1138484524 16:57329576-57329598 AGTTGGGTGGGGATCGCTTGAGG - Intergenic
1138873876 16:60926242-60926264 AGCTTGCTATGGAGCCCTAGGGG - Intergenic
1144577051 17:16435944-16435966 AGTGGGGTGTGGAGTGCTTGGGG - Intronic
1147177392 17:38664281-38664303 AGGCTGGTGTGGAGTCCCTGGGG - Intergenic
1154112889 18:11585551-11585573 AGTTGGGTCTGGGGCTCTTGAGG + Intergenic
1155543301 18:26888551-26888573 AGTTGGGTGTAGACCCCGTGCGG - Intergenic
1162130905 19:8525732-8525754 AGTGAGGTGTTGGGCCCTTGGGG - Intronic
1162837563 19:13331009-13331031 TGTCTGCTGTGGAGCCCCTGGGG - Intronic
1165008258 19:32823906-32823928 AGCCTGGTGTGGGGCCCTCGGGG + Intronic
1166870360 19:45866966-45866988 AGATTGGGGGGAAGCCCTTGGGG - Intronic
1167893920 19:52565478-52565500 ATTTTGGGGTGGAGATCTTGAGG - Intronic
1168267140 19:55229221-55229243 TGTTTGTGGTGGAGCCCCTGAGG - Exonic
928403673 2:30997517-30997539 AGTTCTGAGTGGAGCCCTTTGGG - Intronic
931162227 2:59704515-59704537 AGTTTGCTGTAGAGCCCTCATGG - Intergenic
931667205 2:64617932-64617954 AGTCGGGTGTGGTGCCCTCGAGG - Intergenic
933298853 2:80520689-80520711 ATTTAGAGGTGGAGCCCTTGGGG - Intronic
933839723 2:86276619-86276641 AGATTGGTGTGCAGTCCTGGAGG + Intronic
935394059 2:102586825-102586847 AGGTTGGTGTTGAGGCCTGGAGG - Intergenic
937201404 2:120206557-120206579 AGCTTGGTGGGAAACCCTTGGGG + Intergenic
937671383 2:124541136-124541158 TGTTTGGTGTGGAGACTTAGAGG + Intronic
939256257 2:139747919-139747941 AGTTTGGTATGGAGGGCATGTGG - Intergenic
940748264 2:157595542-157595564 AGTTTGATGTGGAACCATTTAGG - Intronic
948214397 2:236217797-236217819 AGTTTGATGTGGAGTCCTTTGGG + Intronic
1169432344 20:5549111-5549133 AGGATGGTGTTGAGCCCATGTGG + Intronic
1170341897 20:15338381-15338403 ACTTTGAAGTGGAGGCCTTGGGG - Intronic
1171350954 20:24502761-24502783 AGGATGGTGTGAAGGCCTTGGGG + Intronic
1175340444 20:58225997-58226019 TGTCTGGAGTGGGGCCCTTGGGG + Intronic
1175462902 20:59166675-59166697 AGTGTGGTGTGTAGCCTTTGGGG + Intergenic
1177613344 21:23483532-23483554 AGTTTTTTGTGGAATCCTTGGGG - Intergenic
1178564021 21:33666698-33666720 AGGGTATTGTGGAGCCCTTGGGG + Intronic
1178717149 21:34975782-34975804 AGTTGGGTGTGTAGCTCTTGGGG + Intronic
1178718156 21:34985602-34985624 TGTTTAGGGTGGAGCCCTTTGGG + Intronic
1179572630 21:42286927-42286949 AGGCTCGTTTGGAGCCCTTGAGG + Intronic
1180058333 21:45371324-45371346 AGGGGGGTGTGGAGGCCTTGGGG - Intergenic
1182086943 22:27567704-27567726 AGAATGTTGTGGAGCCCTTGGGG + Intergenic
1182428840 22:30288802-30288824 AGCTTGGTGTGGAGAACTAGGGG + Intronic
1183079026 22:35444517-35444539 AGCTTGGCGAGGAGCCCCTGTGG + Intergenic
1184037154 22:41923779-41923801 AGTTTGGAGTCCAGCCCTGGAGG + Intergenic
950469226 3:13174325-13174347 AGTTTGGTCTGCAGCCAATGTGG - Intergenic
950704216 3:14770000-14770022 TGTTTGGTGTTGAGTGCTTGAGG - Intronic
951771252 3:26259956-26259978 AGTTGGGTGTCAAGCCCTTTAGG + Intergenic
953017181 3:39088690-39088712 AGTTATGTGTGGGGCCCTTCAGG + Intronic
953934803 3:47032165-47032187 AGTTTGGTGTGGGGACCTCTAGG - Intronic
957459112 3:80494510-80494532 AGTTGGGGGTGGAGGGCTTGGGG - Intergenic
957866436 3:86029919-86029941 AGTTTGGTGTGGAGCCCTTGAGG + Intronic
965160789 3:165130123-165130145 AGCTTGGTGTGGAGAGCATGGGG - Intergenic
965763593 3:172107164-172107186 AGCTGGGTGTGAAGCACTTGCGG + Intronic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
968822314 4:2863953-2863975 ATTTTGGAGTGGAGACCATGTGG + Intronic
971574737 4:28257965-28257987 AGTTTGGTGTGGAGGGCATTTGG - Intergenic
973386245 4:49516080-49516102 GGCTTGGTGTGGAGCCCTCACGG - Intergenic
983668045 4:170204531-170204553 AGTGTGGTGGGGTGCACTTGTGG + Intergenic
985023946 4:185720698-185720720 ATTTTGGTTTGGAGACCTTGAGG + Intronic
987196929 5:15536188-15536210 AGTCTGCTGTGGAGCCCTCACGG + Intronic
994194670 5:96909186-96909208 TGTTTTGTGTGAAGTCCTTGAGG + Intronic
997238815 5:132292695-132292717 AGTGTTGTGTGGAGCCCTAGTGG - Intronic
1002470984 5:179436033-179436055 ACTTGAGGGTGGAGCCCTTGAGG + Intergenic
1002955293 6:1856724-1856746 TGTTTGGTGTGGAACTCTTTAGG + Intronic
1008912965 6:56756359-56756381 AGATGGGTGTGGAGCACTAGTGG + Intronic
1011981679 6:93386678-93386700 ATGTAGGTGTGGAGCCCTCGTGG - Intronic
1012295620 6:97518386-97518408 ATTTTGGTGGGGAGTCCTTAGGG - Intergenic
1017156410 6:151325968-151325990 CGTTTGGTGGGGAGCCCGGGAGG + Intronic
1017611275 6:156188881-156188903 TTTTTGGTGTGGAGTCCTTTGGG - Intergenic
1020920020 7:14252233-14252255 AGTCTGCTGTTGAACCCTTGTGG + Intronic
1021162629 7:17295669-17295691 AGTTTGTTGTGGTGCTCCTGGGG + Intergenic
1031918297 7:127583341-127583363 AGTTTGCTGTGGGGCTTTTGTGG - Intronic
1032041163 7:128563207-128563229 AAGCTGGTGTGGAACCCTTGGGG + Intergenic
1032708808 7:134444836-134444858 GGTTTGGTCGGGAGCCCCTGGGG - Intronic
1032780193 7:135159038-135159060 AGTTTGTTTTGGAGCCCTAGGGG + Intronic
1033114722 7:138615187-138615209 AGTTGGATGTGGGGCCTTTGGGG + Intronic
1039853920 8:41396562-41396584 AGCTTGGTGTGGAGGCCTTAGGG + Intergenic
1041013878 8:53571505-53571527 AGGTTGGTGTTGAGTGCTTGTGG - Intergenic
1042476393 8:69253450-69253472 GGTTTGGTGGGAAGTCCTTGGGG - Intergenic
1048967484 8:139625134-139625156 AGGCTGGCGTGCAGCCCTTGGGG + Intronic
1049366654 8:142241119-142241141 GGTTTTGTGTGGAGTCCTTGGGG - Intronic
1050074903 9:1853236-1853258 AGTTTGGAGTTGAGTCCCTGTGG - Intergenic
1053485821 9:38455380-38455402 AGTGTGTTGTGGTGGCCTTGTGG + Intergenic
1054927924 9:70606865-70606887 AGTTTGCTATGGATCCCTGGTGG + Intronic
1061328025 9:129875725-129875747 AGTGTGGTGTGGGGTCCTGGTGG - Intronic
1187304981 X:18087082-18087104 AGTTATGTGTATAGCCCTTGTGG + Intergenic
1188052352 X:25503188-25503210 AGCTTGGAGTGGAGGCTTTGAGG + Intergenic
1188952074 X:36388709-36388731 AGCTTGGTGTGGAAGCCTAGAGG + Intergenic
1189781688 X:44520469-44520491 ATCTTGGTGTGTAGCCCTTGGGG - Intergenic
1192024515 X:67434987-67435009 AGTTTTATCTGGAGACCTTGAGG - Intergenic
1195941522 X:110171809-110171831 GGTTTGTTGTGGACCCCATGGGG + Intronic