ID: 957866905

View in Genome Browser
Species Human (GRCh38)
Location 3:86037453-86037475
Sequence AAGCACTAAACTATAATGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957866897_957866905 30 Left 957866897 3:86037400-86037422 CCGTTTAACACTTCAGAGATGAC 0: 1
1: 0
2: 1
3: 20
4: 237
Right 957866905 3:86037453-86037475 AAGCACTAAACTATAATGAAAGG 0: 1
1: 0
2: 1
3: 15
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957866905 Original CRISPR AAGCACTAAACTATAATGAA AGG Intronic
901309236 1:8256395-8256417 AAGAACGAAAGTACAATGAAGGG + Intergenic
903303177 1:22393323-22393345 AAGCACTAAAACAGAATGGAAGG - Intergenic
903841238 1:26242615-26242637 AAGCACTAAACTTGGAAGAAAGG + Intronic
905495134 1:38378917-38378939 TAGCAATATACTATAATAAAAGG - Intergenic
907416822 1:54320170-54320192 AAGCACTGAACAAAAGTGAAAGG + Intronic
911460500 1:98183030-98183052 AAGGACTACAGTATACTGAAGGG - Intergenic
912043693 1:105425774-105425796 AAACACAAAACAATCATGAAAGG - Intergenic
913250465 1:116909131-116909153 AAGCACAAAACTCTATTGTAGGG + Intergenic
915764132 1:158346090-158346112 ACACAATAAACTATCATGAAAGG - Intergenic
916423062 1:164654236-164654258 AAGCACTACATTATAAGTAAGGG - Intronic
917380614 1:174402244-174402266 AAACCCAAAACTAGAATGAAAGG + Intronic
918728293 1:187954120-187954142 AAGCACAAAAGCATAATGGAAGG - Intergenic
919395728 1:197045303-197045325 ATGCAATAAAATATAATAAAGGG + Intronic
919511335 1:198468710-198468732 AAAAACTAAAATATAATTAAGGG - Intergenic
921519604 1:216143610-216143632 AAGCACATAATTAAAATGAAAGG + Intronic
922371603 1:224916767-224916789 AAGAATTAGACTAGAATGAAGGG + Intronic
923737862 1:236628933-236628955 AAGAATTAATCTATAATGAAGGG + Intergenic
1063960241 10:11300574-11300596 AGGGACTAAATTAAAATGAAAGG + Intronic
1064105139 10:12494486-12494508 ATGCACTAAACTGAAATGCAGGG - Intronic
1065700679 10:28422424-28422446 TATCACTAATCTATAATGCATGG + Intergenic
1068897036 10:62216637-62216659 AAGCACTCAACTATTCTAAATGG + Intronic
1069466837 10:68647690-68647712 ACACACAAAAATATAATGAAAGG - Intronic
1070073826 10:73115800-73115822 AAGAACTAAACTTCAGTGAAAGG + Intronic
1070503370 10:77091844-77091866 AAGCACCAAATTACAACGAAAGG - Intronic
1071857674 10:89643142-89643164 AATAGCTAAAATATAATGAAAGG - Intronic
1072268126 10:93749996-93750018 AAGCAATAAACTCCAATCAATGG + Intergenic
1075054144 10:119205934-119205956 GAGCCCTAACCTTTAATGAAAGG - Intergenic
1075265125 10:120993977-120993999 AAATAGTAAACAATAATGAATGG + Intergenic
1077640824 11:3879971-3879993 AAGCATTAGATTATTATGAATGG + Intronic
1077964694 11:7116874-7116896 AGGCACAAAACTTTAATAAATGG - Intergenic
1079837612 11:25353560-25353582 ATGGACTTGACTATAATGAATGG - Intergenic
1080133801 11:28829151-28829173 AAGAACAAAACTGCAATGAAAGG - Intergenic
1083861869 11:65424350-65424372 AAGCACAAAACTAGTATGACCGG - Intergenic
1084345442 11:68544287-68544309 AAGCATCCTACTATAATGAAGGG - Intronic
1085144792 11:74184778-74184800 AAGGACTAAATTTTAATCAATGG + Intronic
1086537008 11:87859364-87859386 ATGCACTCTAATATAATGAAGGG + Intergenic
1087209755 11:95435160-95435182 AAACACTTAACTAAAATGAATGG - Intergenic
1087329459 11:96761926-96761948 AATCACTTAACCATTATGAAGGG + Intergenic
1087634757 11:100689581-100689603 AAGAACAAAACTATAATGATGGG - Intronic
1088979723 11:114851339-114851361 ATGCAGAAAACAATAATGAAGGG - Intergenic
1090068185 11:123521310-123521332 AAGCAATAAACTATATAAAAAGG - Intergenic
1090132326 11:124157776-124157798 AAACTATGAACTATAATGAAAGG - Intergenic
1091557313 12:1584000-1584022 AAGCACTACACATTATTGAAAGG - Intronic
1091939039 12:4458988-4459010 AACTACAAAACTCTAATGAAAGG + Intergenic
1094283670 12:28768554-28768576 AAGCACTAGGATACAATGAATGG - Intergenic
1095929422 12:47610701-47610723 GAGGACTAAGCTCTAATGAATGG + Intergenic
1096736684 12:53660974-53660996 AAGCAGTATAGTATAATGGAAGG + Intronic
1098068710 12:66648312-66648334 AAGCACTAAAGGATGAGGAAGGG - Intronic
1098615070 12:72512756-72512778 AAGCAGGCAACTATAATCAAGGG + Intronic
1099974373 12:89530976-89530998 CAGCACTTAACTGTAGTGAAAGG + Intergenic
1101639254 12:106575078-106575100 GGGCACTAAATAATAATGAAAGG + Intronic
1103143654 12:118574807-118574829 AAGCTCTCAATTATAATGATGGG - Intergenic
1104806675 12:131593715-131593737 AAACAGTAAACTATCAGGAAAGG + Intergenic
1105697604 13:22904173-22904195 AAGCAGTAAACTCTAAGAAAAGG - Intergenic
1106156652 13:27164145-27164167 AAGCACTAAAATAAAATCAAAGG + Intronic
1106394339 13:29366038-29366060 AAGGACAAGACTATAATGAAGGG + Intronic
1106445479 13:29826546-29826568 AAGCAATAAAAAATAATAAAGGG - Intronic
1106491736 13:30230944-30230966 AAGGAATAAACTTTAATGACGGG + Intronic
1106713554 13:32364632-32364654 AAGCAGTAAGCTGTAAAGAAAGG - Intronic
1108130104 13:47289692-47289714 AAGCACTAAACAAGAATGAGTGG + Intergenic
1108481281 13:50874703-50874725 AATCTCAAAACTATAATGATGGG - Intergenic
1109549303 13:63872444-63872466 AAGATCTAAACTCTAATCAAAGG + Intergenic
1109551258 13:63903263-63903285 CAGCACTAATATATAAGGAATGG + Intergenic
1109778531 13:67076613-67076635 AAGAGCTAAACTATGAGGAAGGG + Intronic
1109982777 13:69931491-69931513 AAGGACAAAACTTTAAAGAACGG - Intronic
1112933848 13:104775132-104775154 AAGCAAGAAAATAAAATGAATGG + Intergenic
1113107906 13:106791159-106791181 TAGCACAAAAGTTTAATGAAAGG + Intergenic
1115834780 14:37389204-37389226 AAACACTAAAAAAGAATGAAGGG + Intronic
1116006998 14:39304278-39304300 AAGCATTTAACTTTAAAGAAGGG - Exonic
1116568912 14:46489590-46489612 ATGCTCTTAACTATAATGATTGG - Intergenic
1117199232 14:53371350-53371372 AAGCATTGAACTATTATCAAGGG + Intergenic
1117283001 14:54258735-54258757 AGGCAGTAAACTATGAGGAAAGG - Intergenic
1117355442 14:54919467-54919489 AAGCATTAAAATAAAATAAATGG - Intergenic
1120424384 14:84328747-84328769 AAGCCCTAAGCTAAAATGAGAGG + Intergenic
1122458463 14:101875878-101875900 AAGCAGAAAACTCTAATAAAAGG - Intronic
1126978096 15:54208643-54208665 AAGAACTAAACCAGAATAAAGGG + Intronic
1127244504 15:57157533-57157555 AAGAAGTAAACTATAATTAAAGG - Intronic
1128854797 15:71000791-71000813 AAATAATAAACTATAAAGAATGG - Intronic
1129544534 15:76381262-76381284 AAGGAATAAACTACAATAAATGG - Intronic
1131339038 15:91579027-91579049 AATCACAAAGCTATAATGATTGG + Intergenic
1135609118 16:23849443-23849465 ACTCACTAAACTCTAAAGAATGG - Intronic
1136273284 16:29161476-29161498 AAGCACTACTCAACAATGAAAGG - Intergenic
1140110361 16:71998828-71998850 AAAAAATAAACTATAATGTATGG - Intronic
1140139192 16:72238771-72238793 AACCACTAGACTAGAGTGAATGG - Intergenic
1141385129 16:83615164-83615186 AAGCACTCAAATATATTGCACGG - Intronic
1143854770 17:9840491-9840513 AAGCACTTAAAAATAATGCATGG - Intronic
1144601933 17:16624013-16624035 GAGCAATGATCTATAATGAAAGG + Exonic
1145115624 17:20208547-20208569 TAGCACAAAACTATGATGAAGGG + Intronic
1146230750 17:31106370-31106392 AACCACCAAATTATAAAGAATGG - Intronic
1147348149 17:39818369-39818391 CAACACTATACTATAATAAAAGG + Intronic
1149735974 17:58993854-58993876 AAGCACAAAATCACAATGAAGGG + Intronic
1153130020 18:1844819-1844841 AAGCTTTAAAATACAATGAAAGG - Intergenic
1153717554 18:7866033-7866055 AAGCAATAAAAAATAATAAACGG - Intronic
1155610550 18:27662540-27662562 AAGCACCAAACAATAGTGAAAGG - Intergenic
1155780331 18:29824121-29824143 AATAATCAAACTATAATGAAAGG - Intergenic
1156982766 18:43310497-43310519 AAGCACTAAATTACAAATAAAGG + Intergenic
1157694808 18:49713330-49713352 ATGCAATAAACAATGATGAAGGG - Intergenic
1158920801 18:62188331-62188353 AAGCAATAAACTAGTATAAAAGG - Intronic
1159929971 18:74300597-74300619 AAACACTATACTATAAGGAATGG + Intergenic
1164188202 19:22891452-22891474 AAGCACTATTCTTTAATAAAAGG - Intergenic
924961979 2:43997-44019 GAGCACTAAACCAGAATTAAGGG - Intronic
924977869 2:194606-194628 AAGGAGAAAACTATAATAAAAGG - Intergenic
926532900 2:14073313-14073335 AAAAACTAAAATATAATGGAAGG + Intergenic
926855644 2:17252916-17252938 AAATACTAAACTAAAAAGAAGGG + Intergenic
929274562 2:40011449-40011471 ACGCAATAAACAATGATGAAGGG - Intergenic
929275960 2:40025109-40025131 ACGCAATAAACAATGATGAAGGG + Intergenic
930879018 2:56250979-56251001 CAGAACTAAACTAAAATGGAAGG - Intronic
931550623 2:63441857-63441879 AAGCACTAAATTAAATTTAAGGG + Intronic
931852901 2:66270934-66270956 AACTACTAATCTATAATGAGGGG - Intergenic
933270429 2:80227141-80227163 AAGCAATAAGATATAATAAAGGG - Intronic
935075317 2:99737065-99737087 ACCCACTAAACTATACTAAAAGG - Intronic
936882301 2:117268594-117268616 AAGCACTAGACTCTGATTAATGG - Intergenic
938931688 2:136091869-136091891 AAGTGCTAATTTATAATGAAAGG - Intergenic
939855199 2:147350360-147350382 GATTACTAAACTATAATCAAAGG + Intergenic
939855835 2:147357538-147357560 ATGGATTAAAGTATAATGAAAGG + Intergenic
940334127 2:152507152-152507174 AAGCACTACAGTGAAATGAATGG - Intronic
940466895 2:154042261-154042283 AAACACAAAACTATAATTACTGG - Intronic
942521702 2:176810907-176810929 CAGCACTAAAATATGATGACAGG - Intergenic
942896384 2:181060588-181060610 AAACACTAAAAAAAAATGAAGGG - Intronic
943243268 2:185414321-185414343 AAGTCCTAAACTATTATAAAAGG + Intergenic
944947696 2:204709104-204709126 TAGGAATAAACTATAATAAAAGG - Intronic
947673487 2:231957835-231957857 AGGCAGTAAAAGATAATGAAAGG - Intergenic
948885684 2:240882649-240882671 AAGCATTAAAGGATAATAAAGGG - Intergenic
1170543326 20:17410982-17411004 AAGCACAAAAATATAACCAATGG + Intronic
1170748192 20:19119725-19119747 AAACCCTAAAATATAATGCAAGG + Intergenic
1171402617 20:24887087-24887109 AAGCATGAAAAAATAATGAAAGG + Intergenic
1171802187 20:29633256-29633278 AAGCAGTAAAATAAAATAAATGG + Intergenic
1177384117 21:20386504-20386526 AAAACCTAAACTGTAATGAATGG - Intergenic
1177744869 21:25199479-25199501 AAACAATAAAATATACTGAAGGG - Intergenic
1177786688 21:25679352-25679374 AACCAATAGACTATAAAGAATGG - Intronic
1178323418 21:31623573-31623595 ACCCACAAAACTGTAATGAAGGG + Intergenic
1179435118 21:41357398-41357420 TAGCAGGAAACTAAAATGAATGG + Exonic
949749536 3:7335039-7335061 AAGCTATACACTAGAATGAATGG + Intronic
949828094 3:8184312-8184334 AAATACAAAACTATAATGATGGG - Intergenic
952162892 3:30712973-30712995 AAGCATTAAACTATAATGTAAGG + Intergenic
954595851 3:51823771-51823793 ATGCAGAAAACTACAATGAAAGG + Intronic
955480671 3:59386005-59386027 AAGCACTCATCTATATTAAATGG - Intergenic
956371636 3:68570113-68570135 AATCACTAAACTACAAAGAGAGG - Intergenic
957866905 3:86037453-86037475 AAGCACTAAACTATAATGAAAGG + Intronic
958461388 3:94401458-94401480 AACCACCACACTACAATGAAAGG - Intergenic
959158073 3:102690998-102691020 AAGCAATAAAATAGAATCAAAGG - Intergenic
959402408 3:105919481-105919503 AAGCACTAAACAAAACAGAAAGG - Intergenic
959424670 3:106172026-106172048 AAGCACTAAACTAGAAGTCAGGG + Intergenic
959930268 3:111973734-111973756 AAGCATGAAACTAAATTGAAAGG + Exonic
960077477 3:113504088-113504110 AGGCACTAAACTATCATGGCAGG + Intronic
960531451 3:118770041-118770063 AAGCACTTAGCTATAGTGATGGG + Intergenic
963144773 3:141981628-141981650 AATCACTAAAATATATTGAATGG + Intronic
963210721 3:142686705-142686727 AAGCACCAAACTTTAATGGAGGG - Intronic
967738567 3:192980582-192980604 AAACTGTAAAGTATAATGAAGGG + Intergenic
969829747 4:9785666-9785688 TAGTACCTAACTATAATGAATGG - Intronic
970870838 4:20815037-20815059 AAGCAATAAGCTTTAATGAATGG + Intronic
971318385 4:25585931-25585953 AAACACTAACCTAGAGTGAATGG + Intergenic
971408734 4:26347355-26347377 AAGCACCAAAATTTAAGGAATGG + Intronic
971687824 4:29792049-29792071 AAGCACACACCTCTAATGAATGG - Intergenic
972066129 4:34946995-34947017 AAGTAGTAATGTATAATGAAAGG + Intergenic
973003605 4:44983052-44983074 ATGCACAAATCTATAATAAAAGG + Intergenic
973227821 4:47805955-47805977 AAGCAATAAACTATTATCACTGG - Intronic
974265554 4:59582403-59582425 AAGCACTAAACAACATGGAAAGG - Intergenic
974699932 4:65428662-65428684 AAAAACCAAACTATACTGAATGG - Intronic
975664640 4:76722861-76722883 GCGCACTAAACAATAATGGATGG + Intronic
977101349 4:92819379-92819401 AACCACTGGACTAAAATGAAGGG + Intronic
977120030 4:93088136-93088158 AAGCAGTTAATTATAATTAAGGG + Intronic
977807453 4:101318642-101318664 AAGAACAAAAATATAATCAATGG + Intronic
978156612 4:105496446-105496468 AAGCACTAAACAAAAATTATGGG + Intergenic
979141870 4:117185658-117185680 TAGCTATAAACTAAAATGAATGG + Intergenic
980435684 4:132769731-132769753 AAGAAATAAACTATTAGGAAAGG + Intergenic
980760813 4:137231735-137231757 AAGCATTAAAATATAAACAAAGG - Intergenic
980873971 4:138641953-138641975 AAGCACTAACAAAGAATGAAGGG - Intergenic
981199068 4:141957194-141957216 AAGCTATAAAATATAATTAAAGG - Intergenic
981978044 4:150755489-150755511 AAACACAAAACTATAATTATAGG + Intronic
986239065 5:5940722-5940744 CAGCACTAAGTTAAAATGAAAGG - Intergenic
988826455 5:34940932-34940954 CAGCACTGTACTATAAGGAAAGG - Intronic
989251558 5:39321766-39321788 AATCACTATATAATAATGAAGGG + Intronic
990167195 5:53007743-53007765 AAGCACTAAGTCATAATAAATGG + Intronic
992978811 5:82144487-82144509 ATGCAATAAAATAAAATGAATGG - Intronic
993054448 5:82966082-82966104 TAAAAATAAACTATAATGAAAGG - Intergenic
994326082 5:98446979-98447001 AAGCACTAAAATATTTTTAATGG - Intergenic
994904410 5:105818585-105818607 AAGCACTTAACTTTAATATAAGG + Intergenic
995191308 5:109321749-109321771 ACAAACTAAACAATAATGAAAGG - Intergenic
995470767 5:112499733-112499755 AAGCACAAAACTATAAGGTAGGG - Intergenic
995605137 5:113846009-113846031 CATCACTAAAATATAATGAGTGG + Intergenic
995661591 5:114489698-114489720 CAACACTAAGCTAAAATGAAAGG - Intronic
996955628 5:129180069-129180091 AAGTACTCAACAATAATGATTGG - Intergenic
998440122 5:142152776-142152798 AAGCACTAATCTACAGTAAAAGG - Exonic
999880714 5:155860882-155860904 GAGCTCTAAAGTATAATGCAAGG + Intergenic
1002326555 5:178413494-178413516 AAGCACTGAAGTAGAATAAATGG - Intronic
1002397762 5:178971380-178971402 AAGCTCTAAGCTATAAGGATGGG + Intergenic
1004707275 6:18136150-18136172 AAGGACTAACCTCTAAGGAATGG + Intronic
1009491993 6:64302834-64302856 AAGATGTAAACAATAATGAATGG + Intronic
1012258343 6:97059917-97059939 AAGAAACAAACTATAAAGAAGGG + Intronic
1012547335 6:100434543-100434565 AAGCACGAGAGTAAAATGAATGG + Intronic
1012631823 6:101479720-101479742 AAGCACTAACCTTTAACAAATGG - Intronic
1012994463 6:105959783-105959805 AAGCACTAAATTATAAGCAGTGG - Intergenic
1013177817 6:107692256-107692278 AAGCAATAAAAAATACTGAAAGG - Intergenic
1013504387 6:110785227-110785249 AAGCAATGATCTCTAATGAAGGG - Intronic
1018330892 6:162727180-162727202 AAGCATTAAACTCTAATGGAAGG - Exonic
1018775113 6:167007575-167007597 AAACACTAATAAATAATGAAGGG - Intronic
1021246840 7:18273669-18273691 AAGCACTAATCTCAAAGGAAGGG + Intronic
1022815303 7:33907560-33907582 AACTACTAAACTAAAATAAATGG - Intronic
1026423701 7:70268228-70268250 AAGCACTAAAATGTCATCAAAGG - Intronic
1027669952 7:81084144-81084166 AGGCATTAAAATAAAATGAATGG + Intergenic
1029963060 7:104709116-104709138 AATCCCTAAACTAAAATGCAGGG - Intronic
1030423190 7:109335214-109335236 AATCATTATACTATAATCAATGG + Intergenic
1030576893 7:111298904-111298926 AAGTAATAAACTAAAATAAAGGG + Intronic
1030822828 7:114116403-114116425 AAGCACAAAATAATAATAAATGG + Intronic
1031046555 7:116894926-116894948 AAGCACTTTAATATAATTAATGG - Intronic
1031651966 7:124302562-124302584 AATCACTAATTTATAAAGAAAGG - Intergenic
1032294416 7:130622856-130622878 AAGCACCAAAATATACTCAAGGG + Intronic
1032542050 7:132711254-132711276 TAGCACTAAACTATAAGGGTAGG + Intronic
1033052819 7:138021823-138021845 AATTACTAAAAGATAATGAAAGG + Intronic
1037729890 8:21515493-21515515 AAGCACTAAACTATTCATAAGGG - Intergenic
1038172947 8:25154740-25154762 AGGCACTAACCAATACTGAAAGG + Intergenic
1038203866 8:25445344-25445366 AAGCAGTATATTATACTGAAAGG + Intronic
1038876215 8:31552869-31552891 AAGAAGAAAATTATAATGAAGGG - Intergenic
1039006816 8:33047782-33047804 AAGGCCCCAACTATAATGAATGG - Intergenic
1039669434 8:39580073-39580095 AAGCTTTAAGCCATAATGAAAGG - Intergenic
1041347262 8:56912511-56912533 AAGAACTAGACTGCAATGAATGG - Intergenic
1041969605 8:63723435-63723457 AAGCATCAAAGGATAATGAATGG - Intergenic
1042096773 8:65224783-65224805 GAGCACTAAATAATAAGGAAAGG + Intergenic
1042225113 8:66509123-66509145 CAAGATTAAACTATAATGAATGG - Intronic
1046015950 8:108605417-108605439 ATGAACAAAACTATAATCAATGG - Intergenic
1046055814 8:109076791-109076813 AAGCACTGAACAAGCATGAATGG + Intergenic
1049116469 8:140692740-140692762 AAGCAATACAGTATAGTGAAAGG - Intronic
1050446801 9:5731893-5731915 AACCATTACACTATAAAGAAGGG + Intronic
1053189369 9:36049025-36049047 AAGCACTATACTTTAAATAATGG + Intronic
1054164835 9:61714530-61714552 AAGAGTTTAACTATAATGAATGG - Intergenic
1055199604 9:73644478-73644500 AAGCACAAAAGAAAAATGAAGGG + Intergenic
1058776372 9:108287890-108287912 ATGAACTAAAATATTATGAAGGG - Intergenic
1060714018 9:125904173-125904195 AAGTACGAGACTATAATGACTGG - Intronic
1061698163 9:132393774-132393796 AAGCACTATAATATTATAAATGG + Intronic
1062371979 9:136244735-136244757 AAGCACTAAACAATAAAGTGCGG + Intronic
1203389753 Un_KI270438v1:86775-86797 AAACACTCAAATATAATGGATGG + Intergenic
1186544148 X:10431609-10431631 AAGCAAGAAAATATGATGAAAGG - Intergenic
1186731214 X:12412152-12412174 AAGCACAAATCTATAATAATTGG + Intronic
1188150571 X:26669747-26669769 AATCACTTAACTGTAATCAATGG - Intergenic
1188449403 X:30293692-30293714 TATCAGTAAACTTTAATGAATGG - Intergenic
1191983516 X:66952953-66952975 ATGCAATAAAAAATAATGAAGGG + Intergenic
1193322925 X:80145564-80145586 AAACATTAAAGGATAATGAAAGG + Intergenic
1196146444 X:112323038-112323060 ATGGAATAAACTACAATGAATGG + Intergenic
1200956614 Y:8954826-8954848 AAGTACTAAATTTTATTGAAGGG - Intergenic
1202106001 Y:21366684-21366706 AAGTACTAAATTTTATTGAAAGG + Intergenic