ID: 957870541

View in Genome Browser
Species Human (GRCh38)
Location 3:86085635-86085657
Sequence GACTCTAAAGCATGTTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957870541_957870546 24 Left 957870541 3:86085635-86085657 CCTGGAAAACATGCTTTAGAGTC No data
Right 957870546 3:86085682-86085704 CTACCTTGAAGCTGCTATGCTGG No data
957870541_957870547 25 Left 957870541 3:86085635-86085657 CCTGGAAAACATGCTTTAGAGTC No data
Right 957870547 3:86085683-86085705 TACCTTGAAGCTGCTATGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957870541 Original CRISPR GACTCTAAAGCATGTTTTCC AGG (reversed) Intergenic
No off target data available for this crispr