ID: 957870546

View in Genome Browser
Species Human (GRCh38)
Location 3:86085682-86085704
Sequence CTACCTTGAAGCTGCTATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957870541_957870546 24 Left 957870541 3:86085635-86085657 CCTGGAAAACATGCTTTAGAGTC No data
Right 957870546 3:86085682-86085704 CTACCTTGAAGCTGCTATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957870546 Original CRISPR CTACCTTGAAGCTGCTATGC TGG Intergenic
No off target data available for this crispr