ID: 957871028

View in Genome Browser
Species Human (GRCh38)
Location 3:86090681-86090703
Sequence AAAGTAAAAAAGTTATCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957871028_957871029 -9 Left 957871028 3:86090681-86090703 CCATCAGATAACTTTTTTACTTT No data
Right 957871029 3:86090695-86090717 TTTTACTTTATTTCAAGAACTGG No data
957871028_957871031 24 Left 957871028 3:86090681-86090703 CCATCAGATAACTTTTTTACTTT No data
Right 957871031 3:86090728-86090750 CACCCATCCCTTATGGCACATGG No data
957871028_957871030 17 Left 957871028 3:86090681-86090703 CCATCAGATAACTTTTTTACTTT No data
Right 957871030 3:86090721-86090743 ATATTTTCACCCATCCCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957871028 Original CRISPR AAAGTAAAAAAGTTATCTGA TGG (reversed) Intergenic
No off target data available for this crispr