ID: 957871031

View in Genome Browser
Species Human (GRCh38)
Location 3:86090728-86090750
Sequence CACCCATCCCTTATGGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957871028_957871031 24 Left 957871028 3:86090681-86090703 CCATCAGATAACTTTTTTACTTT No data
Right 957871031 3:86090728-86090750 CACCCATCCCTTATGGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957871031 Original CRISPR CACCCATCCCTTATGGCACA TGG Intergenic
No off target data available for this crispr