ID: 957874224

View in Genome Browser
Species Human (GRCh38)
Location 3:86124562-86124584
Sequence TGGAACTCCTAGGCAAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957874224_957874229 26 Left 957874224 3:86124562-86124584 CCAGTCTTTGCCTAGGAGTTCCA No data
Right 957874229 3:86124611-86124633 TCAACTGGTAATGCCATCTCAGG No data
957874224_957874226 -9 Left 957874224 3:86124562-86124584 CCAGTCTTTGCCTAGGAGTTCCA No data
Right 957874226 3:86124576-86124598 GGAGTTCCATGTGTGTGTGTTGG No data
957874224_957874228 11 Left 957874224 3:86124562-86124584 CCAGTCTTTGCCTAGGAGTTCCA No data
Right 957874228 3:86124596-86124618 TGGAGTACATTAGCATCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957874224 Original CRISPR TGGAACTCCTAGGCAAAGAC TGG (reversed) Intergenic
No off target data available for this crispr