ID: 957874587

View in Genome Browser
Species Human (GRCh38)
Location 3:86129294-86129316
Sequence AGTAATCTGAAGAAGACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957874587_957874588 13 Left 957874587 3:86129294-86129316 CCTGCTGTCTTCTTCAGATTACT No data
Right 957874588 3:86129330-86129352 GCTGCTTTTTGTGTCCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957874587 Original CRISPR AGTAATCTGAAGAAGACAGC AGG (reversed) Intergenic
No off target data available for this crispr