ID: 957876234

View in Genome Browser
Species Human (GRCh38)
Location 3:86149939-86149961
Sequence ATGGTTTAGCACCACCACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957876227_957876234 20 Left 957876227 3:86149896-86149918 CCTGGTGGGAGGTGATTGGATCA 0: 1932
1: 4399
2: 7123
3: 9500
4: 10053
Right 957876234 3:86149939-86149961 ATGGTTTAGCACCACCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957876234 Original CRISPR ATGGTTTAGCACCACCACCT TGG Intergenic
No off target data available for this crispr