ID: 957876744

View in Genome Browser
Species Human (GRCh38)
Location 3:86156602-86156624
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957876737_957876744 29 Left 957876737 3:86156550-86156572 CCAGAAACTGTAAAACTACTCAA No data
Right 957876744 3:86156602-86156624 TCGGTCTAGGCAAAGATTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr