ID: 957879549

View in Genome Browser
Species Human (GRCh38)
Location 3:86193503-86193525
Sequence GTTCTATTTGTACACATTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957879549_957879552 12 Left 957879549 3:86193503-86193525 CCCTTAATGTGTACAAATAGAAC No data
Right 957879552 3:86193538-86193560 GTTCACTACTATAACTCTAGAGG No data
957879549_957879551 -10 Left 957879549 3:86193503-86193525 CCCTTAATGTGTACAAATAGAAC No data
Right 957879551 3:86193516-86193538 CAAATAGAACGAAATCAGATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957879549 Original CRISPR GTTCTATTTGTACACATTAA GGG (reversed) Intergenic
No off target data available for this crispr