ID: 957879550 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:86193504-86193526 |
| Sequence | CGTTCTATTTGTACACATTA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 957879550_957879552 | 11 | Left | 957879550 | 3:86193504-86193526 | CCTTAATGTGTACAAATAGAACG | No data | ||
| Right | 957879552 | 3:86193538-86193560 | GTTCACTACTATAACTCTAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 957879550 | Original CRISPR | CGTTCTATTTGTACACATTA AGG (reversed) | Intergenic | ||