ID: 957879551 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:86193516-86193538 |
| Sequence | CAAATAGAACGAAATCAGAT CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 957879549_957879551 | -10 | Left | 957879549 | 3:86193503-86193525 | CCCTTAATGTGTACAAATAGAAC | No data | ||
| Right | 957879551 | 3:86193516-86193538 | CAAATAGAACGAAATCAGATCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 957879551 | Original CRISPR | CAAATAGAACGAAATCAGAT CGG | Intergenic | ||