ID: 957879552

View in Genome Browser
Species Human (GRCh38)
Location 3:86193538-86193560
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957879550_957879552 11 Left 957879550 3:86193504-86193526 CCTTAATGTGTACAAATAGAACG No data
Right 957879552 3:86193538-86193560 GTTCACTACTATAACTCTAGAGG No data
957879549_957879552 12 Left 957879549 3:86193503-86193525 CCCTTAATGTGTACAAATAGAAC No data
Right 957879552 3:86193538-86193560 GTTCACTACTATAACTCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type