ID: 957884981

View in Genome Browser
Species Human (GRCh38)
Location 3:86275226-86275248
Sequence CCGAACTTGCTCATTTCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957884977_957884981 -1 Left 957884977 3:86275204-86275226 CCATATGCTCTTTAGAAGGGTCC No data
Right 957884981 3:86275226-86275248 CCGAACTTGCTCATTTCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957884981 Original CRISPR CCGAACTTGCTCATTTCCAT GGG Intergenic
No off target data available for this crispr