ID: 957888310

View in Genome Browser
Species Human (GRCh38)
Location 3:86320313-86320335
Sequence GAGGGTGAAGGGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957888310_957888321 3 Left 957888310 3:86320313-86320335 CCCTCCTCCTTCCCTTCACCCTC No data
Right 957888321 3:86320339-86320361 TAGGCTCCAGTGTGTGTTGGTGG No data
957888310_957888320 0 Left 957888310 3:86320313-86320335 CCCTCCTCCTTCCCTTCACCCTC No data
Right 957888320 3:86320336-86320358 GGATAGGCTCCAGTGTGTGTTGG No data
957888310_957888322 4 Left 957888310 3:86320313-86320335 CCCTCCTCCTTCCCTTCACCCTC No data
Right 957888322 3:86320340-86320362 AGGCTCCAGTGTGTGTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957888310 Original CRISPR GAGGGTGAAGGGAAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr