ID: 957888915

View in Genome Browser
Species Human (GRCh38)
Location 3:86329617-86329639
Sequence GTTGCCTCCCTTAGAGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957888912_957888915 -1 Left 957888912 3:86329595-86329617 CCATGAATGTGATGTCTGTTTGG No data
Right 957888915 3:86329617-86329639 GTTGCCTCCCTTAGAGTGGTTGG No data
957888911_957888915 10 Left 957888911 3:86329584-86329606 CCACAAAACTTCCATGAATGTGA No data
Right 957888915 3:86329617-86329639 GTTGCCTCCCTTAGAGTGGTTGG No data
957888910_957888915 14 Left 957888910 3:86329580-86329602 CCTACCACAAAACTTCCATGAAT No data
Right 957888915 3:86329617-86329639 GTTGCCTCCCTTAGAGTGGTTGG No data
957888909_957888915 15 Left 957888909 3:86329579-86329601 CCCTACCACAAAACTTCCATGAA No data
Right 957888915 3:86329617-86329639 GTTGCCTCCCTTAGAGTGGTTGG No data
957888907_957888915 27 Left 957888907 3:86329567-86329589 CCTACTTCCTGGCCCTACCACAA No data
Right 957888915 3:86329617-86329639 GTTGCCTCCCTTAGAGTGGTTGG No data
957888908_957888915 20 Left 957888908 3:86329574-86329596 CCTGGCCCTACCACAAAACTTCC No data
Right 957888915 3:86329617-86329639 GTTGCCTCCCTTAGAGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957888915 Original CRISPR GTTGCCTCCCTTAGAGTGGT TGG Intergenic
No off target data available for this crispr