ID: 957889438

View in Genome Browser
Species Human (GRCh38)
Location 3:86336727-86336749
Sequence TAAACTAGTAATGATGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957889438_957889440 18 Left 957889438 3:86336727-86336749 CCAGCAACATCATTACTAGTTTA No data
Right 957889440 3:86336768-86336790 ACAAAGCATGCTAAGATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957889438 Original CRISPR TAAACTAGTAATGATGTTGC TGG (reversed) Intergenic
No off target data available for this crispr