ID: 957895103

View in Genome Browser
Species Human (GRCh38)
Location 3:86411956-86411978
Sequence TGGCGTTCAGCAGGGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957895103_957895112 19 Left 957895103 3:86411956-86411978 CCGTCCACCCCTGCTGAACGCCA No data
Right 957895112 3:86411998-86412020 GGCTTCCACCCTTCTGGATCCGG No data
957895103_957895113 23 Left 957895103 3:86411956-86411978 CCGTCCACCCCTGCTGAACGCCA No data
Right 957895113 3:86412002-86412024 TCCACCCTTCTGGATCCGGCAGG No data
957895103_957895109 -2 Left 957895103 3:86411956-86411978 CCGTCCACCCCTGCTGAACGCCA No data
Right 957895109 3:86411977-86411999 CACTGTTGCAGATCCGCTGCTGG No data
957895103_957895111 13 Left 957895103 3:86411956-86411978 CCGTCCACCCCTGCTGAACGCCA No data
Right 957895111 3:86411992-86412014 GCTGCTGGCTTCCACCCTTCTGG No data
957895103_957895115 24 Left 957895103 3:86411956-86411978 CCGTCCACCCCTGCTGAACGCCA No data
Right 957895115 3:86412003-86412025 CCACCCTTCTGGATCCGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957895103 Original CRISPR TGGCGTTCAGCAGGGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr