ID: 957895724

View in Genome Browser
Species Human (GRCh38)
Location 3:86419209-86419231
Sequence GCTGAGTGATGGTGTTTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957895724_957895729 16 Left 957895724 3:86419209-86419231 CCTTTTAAACACCATCACTCAGC No data
Right 957895729 3:86419248-86419270 GTTTTGTAGAAGCATGAGCCTGG No data
957895724_957895726 -6 Left 957895724 3:86419209-86419231 CCTTTTAAACACCATCACTCAGC No data
Right 957895726 3:86419226-86419248 CTCAGCCCAAAAATTTGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957895724 Original CRISPR GCTGAGTGATGGTGTTTAAA AGG (reversed) Intergenic
No off target data available for this crispr