ID: 957896564

View in Genome Browser
Species Human (GRCh38)
Location 3:86427520-86427542
Sequence CCGCTCCCATTTAAAACCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957896560_957896564 7 Left 957896560 3:86427490-86427512 CCCAGTAGCTCTTTTACATTTGT No data
Right 957896564 3:86427520-86427542 CCGCTCCCATTTAAAACCTGAGG No data
957896561_957896564 6 Left 957896561 3:86427491-86427513 CCAGTAGCTCTTTTACATTTGTC No data
Right 957896564 3:86427520-86427542 CCGCTCCCATTTAAAACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957896564 Original CRISPR CCGCTCCCATTTAAAACCTG AGG Intergenic
No off target data available for this crispr