ID: 957903032

View in Genome Browser
Species Human (GRCh38)
Location 3:86521685-86521707
Sequence ACTAGGGCTTTGATTGTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957903032_957903035 7 Left 957903032 3:86521685-86521707 CCATTAACAATCAAAGCCCTAGT No data
Right 957903035 3:86521715-86521737 CATATTCTGACATTGAATCCAGG No data
957903032_957903037 28 Left 957903032 3:86521685-86521707 CCATTAACAATCAAAGCCCTAGT No data
Right 957903037 3:86521736-86521758 GGTTATATCACCCATTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957903032 Original CRISPR ACTAGGGCTTTGATTGTTAA TGG (reversed) Intergenic
No off target data available for this crispr