ID: 957903168

View in Genome Browser
Species Human (GRCh38)
Location 3:86523728-86523750
Sequence CTGAATTCGAAGATGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957903168_957903171 -1 Left 957903168 3:86523728-86523750 CCATCCTCCATCTTCGAATTCAG No data
Right 957903171 3:86523750-86523772 GCCATAGAAAATTGCCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957903168 Original CRISPR CTGAATTCGAAGATGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr