ID: 957904393

View in Genome Browser
Species Human (GRCh38)
Location 3:86538677-86538699
Sequence CTTTTTCTGAAGATTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957904391_957904393 -7 Left 957904391 3:86538661-86538683 CCATTAGTCTGTTTTACTTTTTC No data
Right 957904393 3:86538677-86538699 CTTTTTCTGAAGATTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957904393 Original CRISPR CTTTTTCTGAAGATTGAGGA TGG Intergenic
No off target data available for this crispr