ID: 957907191

View in Genome Browser
Species Human (GRCh38)
Location 3:86572580-86572602
Sequence CAGTTTTTCACCACTTAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957907188_957907191 12 Left 957907188 3:86572545-86572567 CCTTGTTGTGTTCCAGATCTTAG 0: 64
1: 159
2: 516
3: 1132
4: 2586
Right 957907191 3:86572580-86572602 CAGTTTTTCACCACTTAGTATGG No data
957907190_957907191 0 Left 957907190 3:86572557-86572579 CCAGATCTTAGAGAAAAGGCTTT 0: 79
1: 476
2: 1150
3: 1429
4: 1805
Right 957907191 3:86572580-86572602 CAGTTTTTCACCACTTAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957907191 Original CRISPR CAGTTTTTCACCACTTAGTA TGG Intergenic
No off target data available for this crispr