ID: 957907909

View in Genome Browser
Species Human (GRCh38)
Location 3:86581447-86581469
Sequence GTTACTTACACATTTACCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957907905_957907909 18 Left 957907905 3:86581406-86581428 CCAAGTGAGTGGCCATAGAGGAG No data
Right 957907909 3:86581447-86581469 GTTACTTACACATTTACCCTAGG No data
957907906_957907909 6 Left 957907906 3:86581418-86581440 CCATAGAGGAGCCAGCAGAGCAG No data
Right 957907909 3:86581447-86581469 GTTACTTACACATTTACCCTAGG No data
957907908_957907909 -5 Left 957907908 3:86581429-86581451 CCAGCAGAGCAGTTTGAGGTTAC No data
Right 957907909 3:86581447-86581469 GTTACTTACACATTTACCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957907909 Original CRISPR GTTACTTACACATTTACCCT AGG Intergenic
No off target data available for this crispr