ID: 957910765

View in Genome Browser
Species Human (GRCh38)
Location 3:86618210-86618232
Sequence AACGAAAGAGTTCTACACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957910758_957910765 28 Left 957910758 3:86618159-86618181 CCTTTCACGGAGGACCTAGCCAT No data
Right 957910765 3:86618210-86618232 AACGAAAGAGTTCTACACCCTGG No data
957910763_957910765 9 Left 957910763 3:86618178-86618200 CCATTATGTGAGGCTGGGAAAGG No data
Right 957910765 3:86618210-86618232 AACGAAAGAGTTCTACACCCTGG No data
957910761_957910765 14 Left 957910761 3:86618173-86618195 CCTAGCCATTATGTGAGGCTGGG No data
Right 957910765 3:86618210-86618232 AACGAAAGAGTTCTACACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957910765 Original CRISPR AACGAAAGAGTTCTACACCC TGG Intergenic