ID: 957915387

View in Genome Browser
Species Human (GRCh38)
Location 3:86682261-86682283
Sequence ATCTACTGGATTGCAGCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957915387_957915393 -1 Left 957915387 3:86682261-86682283 CCTTAGGCTGCAATCCAGTAGAT No data
Right 957915393 3:86682283-86682305 TGGCACTTAGGAGTAATGGGTGG No data
957915387_957915392 -4 Left 957915387 3:86682261-86682283 CCTTAGGCTGCAATCCAGTAGAT No data
Right 957915392 3:86682280-86682302 AGATGGCACTTAGGAGTAATGGG No data
957915387_957915391 -5 Left 957915387 3:86682261-86682283 CCTTAGGCTGCAATCCAGTAGAT No data
Right 957915391 3:86682279-86682301 TAGATGGCACTTAGGAGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957915387 Original CRISPR ATCTACTGGATTGCAGCCTA AGG (reversed) Intergenic
No off target data available for this crispr