ID: 957919962

View in Genome Browser
Species Human (GRCh38)
Location 3:86733876-86733898
Sequence AAACTCCTGCTGTCCCATAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957919962_957919966 29 Left 957919962 3:86733876-86733898 CCGCTATGGGACAGCAGGAGTTT No data
Right 957919966 3:86733928-86733950 TCTCAGGAATTTAGTACAAGAGG No data
957919962_957919965 13 Left 957919962 3:86733876-86733898 CCGCTATGGGACAGCAGGAGTTT No data
Right 957919965 3:86733912-86733934 AAGAACACACTTGTTCTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957919962 Original CRISPR AAACTCCTGCTGTCCCATAG CGG (reversed) Intergenic
No off target data available for this crispr