ID: 957923188

View in Genome Browser
Species Human (GRCh38)
Location 3:86772977-86772999
Sequence CTTGTTTTACCTGCTTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957923188_957923193 1 Left 957923188 3:86772977-86772999 CCAGGACAAGCAGGTAAAACAAG No data
Right 957923193 3:86773001-86773023 CCAGTAGGCCCGAGCTACTAGGG No data
957923188_957923191 0 Left 957923188 3:86772977-86772999 CCAGGACAAGCAGGTAAAACAAG No data
Right 957923191 3:86773000-86773022 CCCAGTAGGCCCGAGCTACTAGG No data
957923188_957923197 10 Left 957923188 3:86772977-86772999 CCAGGACAAGCAGGTAAAACAAG No data
Right 957923197 3:86773010-86773032 CCGAGCTACTAGGGCAACTAGGG No data
957923188_957923195 9 Left 957923188 3:86772977-86772999 CCAGGACAAGCAGGTAAAACAAG No data
Right 957923195 3:86773009-86773031 CCCGAGCTACTAGGGCAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957923188 Original CRISPR CTTGTTTTACCTGCTTGTCC TGG (reversed) Intergenic