ID: 957923191

View in Genome Browser
Species Human (GRCh38)
Location 3:86773000-86773022
Sequence CCCAGTAGGCCCGAGCTACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957923188_957923191 0 Left 957923188 3:86772977-86772999 CCAGGACAAGCAGGTAAAACAAG No data
Right 957923191 3:86773000-86773022 CCCAGTAGGCCCGAGCTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957923191 Original CRISPR CCCAGTAGGCCCGAGCTACT AGG Intergenic
No off target data available for this crispr