ID: 957927509 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:86833363-86833385 |
| Sequence | CTGTATCCGCAAATTGGGAA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 957927509_957927514 | -3 | Left | 957927509 | 3:86833363-86833385 | CCCTTCCCAATTTGCGGATACAG | No data | ||
| Right | 957927514 | 3:86833383-86833405 | CAGAATCAGAAGTTTTGAGTGGG | No data | ||||
| 957927509_957927513 | -4 | Left | 957927509 | 3:86833363-86833385 | CCCTTCCCAATTTGCGGATACAG | No data | ||
| Right | 957927513 | 3:86833382-86833404 | ACAGAATCAGAAGTTTTGAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 957927509 | Original CRISPR | CTGTATCCGCAAATTGGGAA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||