ID: 957927509

View in Genome Browser
Species Human (GRCh38)
Location 3:86833363-86833385
Sequence CTGTATCCGCAAATTGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957927509_957927514 -3 Left 957927509 3:86833363-86833385 CCCTTCCCAATTTGCGGATACAG No data
Right 957927514 3:86833383-86833405 CAGAATCAGAAGTTTTGAGTGGG No data
957927509_957927513 -4 Left 957927509 3:86833363-86833385 CCCTTCCCAATTTGCGGATACAG No data
Right 957927513 3:86833382-86833404 ACAGAATCAGAAGTTTTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957927509 Original CRISPR CTGTATCCGCAAATTGGGAA GGG (reversed) Intergenic
No off target data available for this crispr