ID: 957927513

View in Genome Browser
Species Human (GRCh38)
Location 3:86833382-86833404
Sequence ACAGAATCAGAAGTTTTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957927508_957927513 -3 Left 957927508 3:86833362-86833384 CCCCTTCCCAATTTGCGGATACA No data
Right 957927513 3:86833382-86833404 ACAGAATCAGAAGTTTTGAGTGG No data
957927510_957927513 -5 Left 957927510 3:86833364-86833386 CCTTCCCAATTTGCGGATACAGA No data
Right 957927513 3:86833382-86833404 ACAGAATCAGAAGTTTTGAGTGG No data
957927511_957927513 -9 Left 957927511 3:86833368-86833390 CCCAATTTGCGGATACAGAATCA No data
Right 957927513 3:86833382-86833404 ACAGAATCAGAAGTTTTGAGTGG No data
957927509_957927513 -4 Left 957927509 3:86833363-86833385 CCCTTCCCAATTTGCGGATACAG No data
Right 957927513 3:86833382-86833404 ACAGAATCAGAAGTTTTGAGTGG No data
957927512_957927513 -10 Left 957927512 3:86833369-86833391 CCAATTTGCGGATACAGAATCAG No data
Right 957927513 3:86833382-86833404 ACAGAATCAGAAGTTTTGAGTGG No data
957927507_957927513 1 Left 957927507 3:86833358-86833380 CCTACCCCTTCCCAATTTGCGGA No data
Right 957927513 3:86833382-86833404 ACAGAATCAGAAGTTTTGAGTGG No data
957927505_957927513 30 Left 957927505 3:86833329-86833351 CCTTATAATATTCACTATTATTA No data
Right 957927513 3:86833382-86833404 ACAGAATCAGAAGTTTTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957927513 Original CRISPR ACAGAATCAGAAGTTTTGAG TGG Intergenic
No off target data available for this crispr