ID: 957931522

View in Genome Browser
Species Human (GRCh38)
Location 3:86884564-86884586
Sequence AAACTTAGCATGTCCAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957931522_957931526 19 Left 957931522 3:86884564-86884586 CCAGATTTGGACATGCTAAGTTT No data
Right 957931526 3:86884606-86884628 CAAATGGAAATATGTTAAGCAGG No data
957931522_957931527 20 Left 957931522 3:86884564-86884586 CCAGATTTGGACATGCTAAGTTT No data
Right 957931527 3:86884607-86884629 AAATGGAAATATGTTAAGCAGGG No data
957931522_957931523 3 Left 957931522 3:86884564-86884586 CCAGATTTGGACATGCTAAGTTT No data
Right 957931523 3:86884590-86884612 ATGTGTATGAAACCCTCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957931522 Original CRISPR AAACTTAGCATGTCCAAATC TGG (reversed) Intergenic
No off target data available for this crispr