ID: 957931523

View in Genome Browser
Species Human (GRCh38)
Location 3:86884590-86884612
Sequence ATGTGTATGAAACCCTCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957931522_957931523 3 Left 957931522 3:86884564-86884586 CCAGATTTGGACATGCTAAGTTT No data
Right 957931523 3:86884590-86884612 ATGTGTATGAAACCCTCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957931523 Original CRISPR ATGTGTATGAAACCCTCAAA TGG Intergenic
No off target data available for this crispr