ID: 957931526

View in Genome Browser
Species Human (GRCh38)
Location 3:86884606-86884628
Sequence CAAATGGAAATATGTTAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957931522_957931526 19 Left 957931522 3:86884564-86884586 CCAGATTTGGACATGCTAAGTTT No data
Right 957931526 3:86884606-86884628 CAAATGGAAATATGTTAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957931526 Original CRISPR CAAATGGAAATATGTTAAGC AGG Intergenic
No off target data available for this crispr