ID: 957935942

View in Genome Browser
Species Human (GRCh38)
Location 3:86942768-86942790
Sequence TATCTCCTATACCAGGTAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957935940_957935942 26 Left 957935940 3:86942719-86942741 CCTTCAGAAATGACATACTAAAA 0: 1
1: 0
2: 3
3: 39
4: 403
Right 957935942 3:86942768-86942790 TATCTCCTATACCAGGTAGAAGG 0: 1
1: 0
2: 0
3: 5
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957935942 Original CRISPR TATCTCCTATACCAGGTAGA AGG Exonic
900715541 1:4141308-4141330 AATCTCCCATTCCAGGGAGACGG + Intergenic
901020787 1:6254293-6254315 TATCTCCTATGCAAGGAACAAGG - Intronic
902539752 1:17145781-17145803 TCTCTCCTATGGCAGGTATATGG - Intergenic
906440281 1:45837134-45837156 TATATTCTATACCAGGTCCATGG - Intronic
906440295 1:45837212-45837234 TATATTCTATACCAGGTCCATGG - Intronic
922676665 1:227557324-227557346 TATCTCCTAGCCCAGGAAGGAGG + Intergenic
1063196992 10:3752864-3752886 TGTTTCCTATCCCAGGGAGAGGG + Intergenic
1064532789 10:16327180-16327202 TATCTACAAAACCAGGTAGTGGG - Intergenic
1066213439 10:33262905-33262927 TTTCTCTTCTGCCAGGTAGAAGG - Intronic
1068460602 10:57323490-57323512 TATCTCTAAGACCAGGCAGAAGG + Intergenic
1069536597 10:69258117-69258139 TATCTCCCATGCCAGGTAAGAGG + Intronic
1072804702 10:98417191-98417213 TCTCTCCTACCCCAGGTAAAAGG - Exonic
1074059782 10:109954461-109954483 TATCTCCCCTGCCAGGCAGAGGG - Intergenic
1075911768 10:126131211-126131233 TATATCCTGGACCAGGTTGAGGG - Intronic
1081984663 11:47292901-47292923 TATCTCCCACACCTGTTAGAAGG + Intronic
1085259516 11:75196239-75196261 TATCTTGTATACCCTGTAGAAGG + Intronic
1085572928 11:77575009-77575031 TATCTCCTAGCCCAGGAAGGAGG + Intronic
1090353086 11:126120279-126120301 TATGTCCTATACAAAGTATAGGG - Intergenic
1092234102 12:6795357-6795379 TACCTCCTCTTCCAGGCAGATGG + Intronic
1102810282 12:115818453-115818475 TATCTCCTGTCCCAGTTGGAAGG - Intergenic
1103283732 12:119782887-119782909 TATCTCCTAGGACAGGTAGATGG - Intronic
1103867506 12:124064578-124064600 TATCTCCTGGACCAGCTAGTGGG + Intronic
1108624863 13:52217919-52217941 AATCACCTATACCTGGGAGACGG + Intergenic
1108661190 13:52588499-52588521 AATCACCTATACCTGGGAGACGG - Intergenic
1111598464 13:90441331-90441353 TATCGCCTGAACCAGGGAGATGG + Intergenic
1111685786 13:91499204-91499226 TATCTCCAAGAGCAGGAAGAGGG + Intronic
1112559168 13:100496649-100496671 TATTTCCTTTACCAGATAAATGG - Intronic
1117004330 14:51403167-51403189 TTTTTCTTAAACCAGGTAGATGG - Intergenic
1117973638 14:61276767-61276789 GATCTCCTATGACAGGAAGACGG + Intronic
1118422193 14:65618895-65618917 AATCTTCTAACCCAGGTAGAAGG - Intronic
1118607313 14:67513987-67514009 TCTCTGCTGTACCAGGAAGAGGG - Intronic
1125071753 15:35563008-35563030 TATGTCCTATAGCAGGTAGCTGG + Intergenic
1126337997 15:47607470-47607492 TACCTACTATACCAAGTAGTTGG + Intronic
1133382925 16:5346076-5346098 TGTCTCCTTCACCAGGTAGTGGG - Intergenic
1135189603 16:20344119-20344141 GATCTCATCTGCCAGGTAGAGGG + Exonic
1143356474 17:6332766-6332788 TCTCTCTTCTACCAGCTAGAGGG - Intergenic
1158996396 18:62924883-62924905 AATCTGCTATACCTGGTAGCAGG + Intronic
1160395323 18:78566715-78566737 TATTTCCTATGACAGGGAGAAGG + Intergenic
1161826297 19:6568395-6568417 AATCTCCTACACCAGGTATTTGG + Intergenic
1164033352 19:21431616-21431638 TATCTCCTAGCCCAGGAAGAAGG - Intronic
1166587342 19:43961063-43961085 TATCTCTTATACCAGGATGTGGG + Intronic
926357741 2:12056833-12056855 TTTCTCCTATTCCAAGGAGATGG - Intergenic
926601979 2:14855012-14855034 TTTCTCCTCTAGCAGGTGGAAGG - Intergenic
929270372 2:39965001-39965023 TAACTCCTATAGCATCTAGAGGG + Intergenic
931986650 2:67748498-67748520 CATCTCCTCTACCAGGAAAATGG + Intergenic
944902744 2:204232152-204232174 TATCTCCTATCCAAAGGAGAAGG - Intergenic
1169733603 20:8812849-8812871 TATTTCCTTTAACAGTTAGAAGG + Intronic
1175411023 20:58769113-58769135 TACCTCCTTTACCAAGGAGATGG - Intergenic
1179371724 21:40811994-40812016 ACTCTCCAATACCAGGAAGATGG - Intronic
1179573865 21:42294646-42294668 CATCTCCTATGTCAGGTAGCGGG + Exonic
1184631880 22:45788069-45788091 AATCTCCTAAAGCGGGTAGATGG - Intronic
1185308022 22:50133248-50133270 TATCTCCTCAACCTGATAGAGGG - Intronic
951738120 3:25890162-25890184 TATTTCCTATACCACTTAAATGG - Intergenic
952594473 3:34999671-34999693 TAGCTTCTATTCCAGGAAGATGG + Intergenic
956445404 3:69321129-69321151 CATCTCCTAAACCAGGCAGTGGG - Intronic
957935942 3:86942768-86942790 TATCTCCTATACCAGGTAGAAGG + Exonic
961771331 3:129252347-129252369 TATCTCATAAACCAGGTAACAGG + Exonic
961930698 3:130529838-130529860 TATCTCCAACACCTGGTATATGG + Intergenic
962639002 3:137363736-137363758 TATTTCCTCAACCAGGTAAAGGG + Intergenic
963563727 3:146901056-146901078 TATTTCCTTTTCCAAGTAGAGGG + Intergenic
964745255 3:160006346-160006368 TATCTCCTATATCATGTAGGAGG + Intergenic
969783063 4:9426174-9426196 AATCTGTTATACCAGGAAGAAGG + Intergenic
969848407 4:9937605-9937627 CATCTCCTAAACCGGGCAGAGGG - Intronic
970763007 4:19514506-19514528 TATCTGCTACACCAAGTAGAAGG - Intergenic
978200262 4:106017304-106017326 AATTTCCTATACCAGGTATCAGG - Intergenic
982217220 4:153092777-153092799 TATCTCCTTTAAAAGGTAAATGG + Intergenic
982463582 4:155702353-155702375 TTTCTACTGTACCAAGTAGATGG + Intronic
987929248 5:24382420-24382442 TATCTCCTATATCTGATAAATGG - Intergenic
989439164 5:41449920-41449942 TACCTCCCCTAACAGGTAGATGG + Intronic
990112649 5:52347039-52347061 CATCTCCTGTACTAGGGAGAAGG - Intergenic
992888427 5:81182133-81182155 CATCTCCAATTCCAGTTAGAGGG + Intronic
994965938 5:106670585-106670607 TATCCCCTATACTATGTAAATGG - Intergenic
1000341448 5:160280119-160280141 TATCCCCCATACCAGGAAGCAGG + Intronic
1001130351 5:169058499-169058521 TATCTCATATATCAGGCAGCAGG - Intronic
1003000057 6:2323868-2323890 TATATTCTATACCAGCTGGATGG + Intergenic
1003436534 6:6093996-6094018 CATATTCTATACAAGGTAGAAGG - Intergenic
1006575466 6:35042065-35042087 TATTTCTTAAACCAGGTAGTAGG + Intronic
1008131993 6:47729391-47729413 TCTCACCTAAACCAGGTTGATGG - Intergenic
1008569682 6:52804496-52804518 TTTCACCTATACCATGTAGGGGG + Intergenic
1010404307 6:75485508-75485530 TATCACATATCCCAGGTAGTGGG - Intronic
1018523700 6:164682988-164683010 AATTTCCTTTACCAGGCAGAGGG - Intergenic
1020694079 7:11392906-11392928 TCTATCCTATCCCAGGGAGATGG - Intronic
1021633617 7:22669657-22669679 TTTTTCCCATACCAGGTTGAAGG + Intergenic
1023473731 7:40553822-40553844 TATCCCCTATATCAGATAGTGGG + Intronic
1025823268 7:64991339-64991361 TACCTCCTAGCCCAGGAAGAGGG - Exonic
1026831679 7:73614128-73614150 AATCTCTTAAACCAGGGAGACGG + Intronic
1028031371 7:85918325-85918347 CATATCCTTTAGCAGGTAGATGG - Intergenic
1035431004 7:158821729-158821751 TAACTCCTCCACCTGGTAGAAGG - Intronic
1036835997 8:12067884-12067906 AATCAGCTATACCAGGAAGAAGG - Intronic
1036857840 8:12314454-12314476 AATCAGCTATACCAGGAAGAAGG - Intergenic
1038865217 8:31432321-31432343 TTTCTCTCATAACAGGTAGAGGG + Intergenic
1043881982 8:85554476-85554498 AATCTCCTAAACCTGGGAGATGG - Intergenic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1044699678 8:94954451-94954473 TATCTCCTCTACTAGATGGAAGG - Intronic
1047896809 8:129375243-129375265 TATATGCAATAGCAGGTAGAGGG - Intergenic
1056896609 9:90556689-90556711 TGGCTGCTTTACCAGGTAGAAGG - Intergenic
1056974691 9:91241159-91241181 TAACACCTATCCCAGGTACATGG + Intronic
1060310423 9:122454686-122454708 TGTGTCCATTACCAGGTAGAAGG + Intergenic
1061100170 9:128486132-128486154 TATCTCCTCTACAGAGTAGAGGG - Intronic
1193293272 X:79803933-79803955 TAACTCTTATACTAAGTAGAAGG - Intergenic
1195267787 X:103199988-103200010 CATCTTCTCTACCAGTTAGATGG + Intergenic
1198393040 X:136195779-136195801 CATCTCCCCTACCAGGTTGAGGG - Intronic
1198404145 X:136295780-136295802 CACCTCCTCCACCAGGTAGATGG + Intergenic
1199029830 X:142984399-142984421 TCTCTCCTATACCACCAAGATGG + Intergenic
1199398697 X:147371254-147371276 AATATCTTATACCAGTTAGAAGG - Intergenic