ID: 957939885

View in Genome Browser
Species Human (GRCh38)
Location 3:86991104-86991126
Sequence TCCCCACGGCTGCCCGACCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957939885_957939892 15 Left 957939885 3:86991104-86991126 CCCGGGTCGGGCAGCCGTGGGGA 0: 1
1: 0
2: 3
3: 17
4: 178
Right 957939892 3:86991142-86991164 GCATATACACAATGCACGCCCGG 0: 1
1: 0
2: 0
3: 2
4: 50
957939885_957939893 16 Left 957939885 3:86991104-86991126 CCCGGGTCGGGCAGCCGTGGGGA 0: 1
1: 0
2: 3
3: 17
4: 178
Right 957939893 3:86991143-86991165 CATATACACAATGCACGCCCGGG 0: 1
1: 0
2: 0
3: 2
4: 47
957939885_957939894 17 Left 957939885 3:86991104-86991126 CCCGGGTCGGGCAGCCGTGGGGA 0: 1
1: 0
2: 3
3: 17
4: 178
Right 957939894 3:86991144-86991166 ATATACACAATGCACGCCCGGGG 0: 1
1: 0
2: 0
3: 0
4: 12

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957939885 Original CRISPR TCCCCACGGCTGCCCGACCC GGG (reversed) Exonic
900148120 1:1167103-1167125 TGGCCACGGCTGCCCGAGCTGGG - Intergenic
900289756 1:1918921-1918943 TCCCCACAGGTGCCCGCCCCAGG - Exonic
900366305 1:2313266-2313288 TCCCCACGGTTCCCTGTCCCTGG - Intergenic
900603397 1:3512912-3512934 TCCCCAAGGCTGCTTGGCCCAGG + Intronic
900962564 1:5934605-5934627 TCCCCACTGCTCCCAGTCCCGGG + Intronic
901204292 1:7485047-7485069 TCCCCAGAGCTGCCCGGACCTGG + Intronic
902375268 1:16027441-16027463 CCCCCTGGGCTGCCTGACCCTGG + Intronic
902380230 1:16049251-16049273 CCCCCTGGGCTGCCTGACCCTGG + Intronic
902668153 1:17953632-17953654 TCTCCAGGGCTCCCTGACCCTGG - Intergenic
903876455 1:26477591-26477613 TCCTCACAACTGCCCGACCTCGG - Intergenic
904365889 1:30010667-30010689 TCCCCAAGGTTGCCCCACGCCGG - Intergenic
904744478 1:32702654-32702676 TGGCCATGGCTGCGCGACCCCGG + Exonic
906207464 1:43994882-43994904 TCCCCTCGCCTGCCTCACCCTGG - Intronic
906380186 1:45327611-45327633 TCCACGCGGCTGACCCACCCGGG - Exonic
908612822 1:65881358-65881380 ACCCCATGGCTGCCCCAGCCAGG - Intronic
915087141 1:153396548-153396570 TGCCCACCGGTGCCGGACCCAGG - Intergenic
915530775 1:156500944-156500966 TCCCCAGGGCTGGCCGGGCCAGG + Intergenic
916500526 1:165383307-165383329 TCACCAAGGCTGGCCGAGCCAGG - Intergenic
917141618 1:171841402-171841424 GCCCCGCGGCTGCCCCGCCCCGG - Intergenic
917854466 1:179089704-179089726 TCCCCTGGACTGCCCGACCCAGG - Intronic
918075984 1:181171907-181171929 TCCCCACTGCTGCCCTACAAGGG - Intergenic
920951517 1:210575493-210575515 TCCCCAGGGCTCCCAGGCCCAGG - Intronic
921101666 1:211933927-211933949 TACACTCAGCTGCCCGACCCTGG - Intergenic
921394440 1:214653408-214653430 TCCACACGTCTGCCTGACCAAGG - Intronic
922113212 1:222583230-222583252 TCCTCACAGCTGCCGGACACTGG - Intronic
923517084 1:234707033-234707055 GCCCCATGGCTTCCCGGCCCTGG + Intergenic
924007747 1:239630894-239630916 TCCCCACTGCTGCCCTCCCCCGG - Intronic
1064145333 10:12822355-12822377 TCCCCACTGCTGCACAGCCCAGG + Intronic
1064990751 10:21254820-21254842 TGCCCATGACTGCCTGACCCTGG + Intergenic
1069593573 10:69656386-69656408 TCCCCTCCGCTCCCCTACCCAGG - Intergenic
1073461282 10:103667309-103667331 TCCCCACGACTCCCCAACCCTGG + Intronic
1074419651 10:113297860-113297882 TCCCCTCCGCTGCCCCAACCAGG + Intergenic
1076685533 10:132196919-132196941 TCCCCACGCCTGCCCTTACCTGG - Exonic
1077232089 11:1462290-1462312 CCCCCACGGCCGCCGCACCCGGG - Intronic
1077353680 11:2104910-2104932 TCCCCATGGCTGCCCTCACCTGG - Intergenic
1077368992 11:2172828-2172850 TCCCAGCCGCTGCCCCACCCAGG + Intergenic
1077505893 11:2929801-2929823 TCCCCACGGTGGGCCGGCCCCGG - Intergenic
1078581705 11:12544007-12544029 TACCCACTGCTGCCAGCCCCAGG - Intergenic
1078606918 11:12785138-12785160 TCCCCACGGCTCCCAGGCACAGG - Intronic
1082809160 11:57468145-57468167 GCCCCTCTGCTCCCCGACCCTGG + Intronic
1085475024 11:76783989-76784011 TCCCCACCGCTACCCGGCCGGGG + Intronic
1086437122 11:86792400-86792422 TTCCCACTGCTGCTAGACCCTGG + Intronic
1087155020 11:94893987-94894009 TGCCCACGTGTGCCCCACCCGGG - Intergenic
1088595033 11:111435055-111435077 TCCCCAGGGCTGCCCGGTTCTGG + Intronic
1089800695 11:121024428-121024450 TCCCCACAGCTGCTCGAGACAGG - Intronic
1090830700 11:130419023-130419045 TCCCCAGGGCTTCCGGAGCCAGG + Intronic
1093706131 12:22276598-22276620 CCCCCACCCCTGCCCGACTCTGG + Intronic
1101640617 12:106583777-106583799 TCCGCTCGGCTTCCCGGCCCTGG - Intronic
1102003584 12:109573882-109573904 GCCGCCCGGCCGCCCGACCCCGG - Intronic
1102076235 12:110062399-110062421 TCCCCATGGTTGCTCAACCCAGG - Intronic
1102248292 12:111368847-111368869 GGCCCAGGGCGGCCCGACCCGGG + Intronic
1102592795 12:113969672-113969694 TCCCCACTGTTGCCAGGCCCTGG - Intergenic
1102644633 12:114396182-114396204 GCCCCGCGGCTGCCCGACCCCGG + Intronic
1104424372 12:128662947-128662969 TACCCACAGCTGACTGACCCTGG - Intronic
1105642841 13:22284220-22284242 TCCCCACCGCTCCCCGGCCCTGG + Intergenic
1105704845 13:22962413-22962435 TCCCCAGGCCTCCCCAACCCGGG + Intergenic
1106048649 13:26169236-26169258 TCTCCACGGCTCCCTGAGCCTGG - Intronic
1107432564 13:40352979-40353001 TGCCCACAGCTGCCCCAGCCTGG + Intergenic
1112438536 13:99408612-99408634 TCCGCACGGCTGGCCGCGCCAGG - Intergenic
1113519482 13:110929448-110929470 GCCCCTCAGCTGCCTGACCCTGG + Intergenic
1119703944 14:76772647-76772669 TCCCCGCAGCTGCCTGAGCCTGG - Intronic
1120496244 14:85240102-85240124 TCCCCACCCCTGCCCAACCATGG + Intergenic
1121017661 14:90558217-90558239 TCAGCAAGGCTGCCAGACCCTGG + Intronic
1123070883 14:105642037-105642059 TCCCCACAGCTGCCTGCCCTGGG + Intergenic
1123090544 14:105740321-105740343 TCCCCACAGCTGCCCGCCCTGGG + Intergenic
1123096175 14:105768071-105768093 TCCCCACAGCTGCCCGCCCTGGG + Intergenic
1127051633 15:55089914-55089936 TGCCCACAGCTGCCTGCCCCGGG + Intergenic
1128473271 15:67974711-67974733 TCCCCAGTGCTGCCTGCCCCAGG + Intergenic
1132579306 16:677819-677841 TCCCCGCCGCTGCCCGCCTCGGG + Exonic
1132648357 16:1009452-1009474 TCCCCACTGCTCACAGACCCCGG - Intergenic
1132719122 16:1307364-1307386 TCCCCACGGCTGCGCCTCCCAGG + Intergenic
1133225976 16:4340548-4340570 TCCCCAGGCCACCCCGACCCTGG - Intronic
1135777714 16:25271552-25271574 TCCCCACTGCTGCCCTCCCTTGG + Intergenic
1139481014 16:67230725-67230747 TCTCCTCGGCTGCCCGGCTCCGG + Exonic
1140520620 16:75577990-75578012 TGGCCATGGCTTCCCGACCCAGG - Intergenic
1141620621 16:85235118-85235140 TCCTCACCGCTGCCCCTCCCAGG + Intergenic
1141722837 16:85766337-85766359 TCCCCACACCTGCCTTACCCAGG - Intergenic
1141993770 16:87624318-87624340 TTCCCACGGCTCCCCACCCCTGG + Intronic
1142220740 16:88853785-88853807 TCCCCAGGGCTGCCCTGCCCTGG - Intronic
1142664587 17:1455643-1455665 TCCCCGCGGCTGCCCTCCCCAGG + Intronic
1143510556 17:7393284-7393306 TCTCCTCGGCCGCCTGACCCAGG + Exonic
1144740408 17:17579115-17579137 CCCCCAGGGCTGGCTGACCCTGG - Intronic
1145017381 17:19408144-19408166 TCCCCACCTCTGCCCCACCATGG + Intergenic
1146260590 17:31417643-31417665 TCCCCACCGCAGCCCCACCTAGG - Intronic
1148777974 17:50106125-50106147 TCCCCTCAGCAGCCCGGCCCTGG - Intronic
1151671816 17:75575046-75575068 TCCCCTGGGCTGCCCTTCCCGGG + Exonic
1152409902 17:80117985-80118007 ATCCCACGGCTGCCCGAGGCCGG - Intergenic
1152420029 17:80187725-80187747 TCCCCAGGGCTGCCACACCCAGG + Intronic
1152542268 17:80982277-80982299 GACCCACGGCTGCCTGGCCCAGG - Intergenic
1153794464 18:8609662-8609684 GCCCCCCGGCTGCGCGCCCCGGG - Exonic
1154294282 18:13135983-13136005 TCCCCACGACCGCCCTAGCCCGG - Intergenic
1156447878 18:37250389-37250411 TCCCCACAGCTGCCCTGCCTAGG + Intronic
1156457707 18:37303994-37304016 TACCCACTACTGCCTGACCCAGG + Intronic
1157612088 18:48963510-48963532 TCCCCAAGGGTTCCCTACCCAGG + Intergenic
1157815955 18:50729653-50729675 GCCCCCCGGCCGCCCGGCCCCGG + Exonic
1158503183 18:58022035-58022057 TCCCCATGGCTCCCCGACCCAGG - Intergenic
1161086298 19:2337123-2337145 TCCCCACCGCAGCCCCACCACGG - Intronic
1161338927 19:3730174-3730196 CCCCCACAGCGGCACGACCCAGG - Intronic
1161455259 19:4366716-4366738 TCCCCACAGCTGCCTGCCCACGG + Intronic
1161672580 19:5622445-5622467 TCACCGCGGCTCCCGGACCCGGG - Intronic
1164648078 19:29873539-29873561 TCCCCCGGGCTGCGCCACCCAGG - Intergenic
1165106533 19:33473060-33473082 GCCCCACGTCTGCCCGTCCCTGG - Intronic
1165730051 19:38139474-38139496 TCCCCACCTCTGCCCGGGCCTGG + Intronic
1165822314 19:38684412-38684434 TTCCCAGTGCTGCCCCACCCTGG + Intronic
1167011749 19:46813329-46813351 TCCCCACGGTAGCCCGAGGCTGG - Intergenic
1167162815 19:47778874-47778896 TCCCCGGGGCTCCCTGACCCCGG - Intronic
1168538566 19:57191835-57191857 ACCCCACCTGTGCCCGACCCTGG - Exonic
925306122 2:2849187-2849209 TCCCCAAAGCTGTCCCACCCAGG + Intergenic
926116712 2:10218079-10218101 TCCCCACTGCTGCCAGTGCCCGG + Intergenic
927558052 2:24049797-24049819 TCCCTGCTGCTGCCCGACCCCGG - Exonic
931868287 2:66434255-66434277 TCCCAGCGGCTCCCCGGCCCCGG + Intronic
932780560 2:74556104-74556126 CTCCCACAGCTGCCCAACCCAGG - Intronic
933902887 2:86861951-86861973 CCCCCCCAGCTCCCCGACCCAGG - Intergenic
934848232 2:97677137-97677159 TCCACACTGCTGCCCGTCACAGG - Intergenic
935777658 2:106487319-106487341 CCCCCCCAGCTCCCCGACCCAGG + Intergenic
936059313 2:109284004-109284026 TCCCCTCGGCTTTCCTACCCAGG - Intronic
937911689 2:127078717-127078739 TCCCCACTGCTGCCCCTCCCTGG + Intronic
938801390 2:134766531-134766553 TCCCCAGGTCTCCCGGACCCAGG - Intergenic
943639530 2:190343608-190343630 CCCCCACGCCTGCCCGAGCCGGG - Exonic
947816788 2:233042744-233042766 TCCAGCCAGCTGCCCGACCCAGG + Intergenic
948536346 2:238650364-238650386 TCCCCACTGTTGCCAGCCCCTGG - Intergenic
948890701 2:240905697-240905719 TGCCCACGGCTTCCCACCCCAGG - Intergenic
948908489 2:240991332-240991354 TCCCCAGGGCCGCCTGCCCCTGG - Intronic
949059663 2:241949541-241949563 TCCCCACGGCCCCCTGACCGCGG - Intergenic
1172599663 20:36175092-36175114 GCCCCACCGCCGCCCGCCCCGGG - Intronic
1175868231 20:62192848-62192870 TCCACACGGCTGCACAACCGCGG - Intronic
1175940218 20:62534342-62534364 TTCCCACGCCTGCCCAAGCCAGG - Intergenic
1178915065 21:36701445-36701467 GCCCCGCGGCTCCCCGGCCCAGG + Intronic
1179187696 21:39097349-39097371 TCCCCACGGCCTCCCTGCCCTGG + Intergenic
1180032915 21:45224490-45224512 TCCCCACAGCTGCCCCACCCAGG - Exonic
1180033006 21:45224721-45224743 TCCCCACAGCCGCCCCGCCCAGG - Exonic
1180087573 21:45514857-45514879 CCCCCAAGGCTGCCCAGCCCAGG + Exonic
1180177864 21:46098803-46098825 TCCCCAGGGCGGCGGGACCCGGG + Intronic
1181027070 22:20132467-20132489 TCCTCCTGGCTGCCCGCCCCGGG + Intronic
1182446888 22:30394957-30394979 TCCCCAGGCCTGCCCTTCCCAGG - Intronic
1183616629 22:38949931-38949953 TCCCCACTGCTGGCCAGCCCTGG + Intergenic
1183942126 22:41301860-41301882 TCCCCAGCCCTGCCCGGCCCGGG - Intronic
1184234386 22:43175175-43175197 TCCCCTTGGCTGCCCAAACCTGG - Intronic
949127500 3:464005-464027 TTCACAAGGGTGCCCGACCCAGG - Intergenic
950456784 3:13097443-13097465 TGCCCAAGGCTCCCAGACCCTGG + Intergenic
954124537 3:48520819-48520841 TCCCAAGGGCTGCCAGGCCCAGG + Intronic
954304429 3:49717926-49717948 TGCCCAGGGCTCCCCCACCCAGG - Exonic
954682865 3:52355349-52355371 TCCCCAGGGCTGCCTGAGCTTGG + Intronic
954693780 3:52409922-52409944 TCCCCACCGCTGCCCCCACCGGG + Exonic
957939885 3:86991104-86991126 TCCCCACGGCTGCCCGACCCGGG - Exonic
967969161 3:194986479-194986501 CTCCCACGGCTCCCCGTCCCAGG + Intergenic
968313986 3:197706980-197707002 GTCCCACGGCTGCCCAGCCCTGG - Intronic
968760981 4:2442733-2442755 TCCCCACGGCAGCCCACCCAGGG + Intronic
968803171 4:2756255-2756277 TCCTCCCAGCCGCCCGACCCCGG + Exonic
969113300 4:4856818-4856840 GCCCCTCGGCTTCCCGAGCCGGG - Intergenic
969460015 4:7324058-7324080 TCCCCAAGCCTGCAAGACCCTGG - Intronic
976217808 4:82731307-82731329 TCCCCAAGGCTGTCCTAGCCAGG - Intronic
981247510 4:142557183-142557205 TCCCATCAGCTGCCCTACCCTGG - Intronic
985801269 5:2006709-2006731 TCCCCACCCCTGCCACACCCTGG + Intergenic
992782856 5:80143677-80143699 TCCCCTCTGCTGCCCCACCCGGG - Exonic
995493916 5:112721957-112721979 TCCCCAGGGCTGCATGGCCCAGG - Intronic
998103623 5:139454774-139454796 TCCCCTCTGCTGGCGGACCCAGG - Intronic
1002938864 6:1698707-1698729 TGCCCACGTGTGCGCGACCCTGG + Intronic
1003142299 6:3481643-3481665 TTCCCACTGCTGCCAGACTCTGG + Intergenic
1003186426 6:3835368-3835390 TCCCCACTATTGCCCAACCCAGG + Intergenic
1004302889 6:14474702-14474724 TCCCCACATCTGCTCCACCCAGG + Intergenic
1005361912 6:25038914-25038936 TCCCCACGGGGGCCAGGCCCTGG - Intronic
1006034743 6:31202537-31202559 CCCCCACAGCTGCCCAGCCCTGG - Exonic
1006515558 6:34543892-34543914 TCCCCAAAGCTGCCCGAGGCTGG + Intronic
1008554028 6:52657539-52657561 ACTCCAAGGCTGCCCCACCCCGG + Intergenic
1010787758 6:80024584-80024606 TCCCCACTGCTCCCAGCCCCTGG - Intronic
1016608679 6:145963984-145964006 TCCCCACCTCTTCCCGATCCCGG - Intronic
1019488230 7:1299203-1299225 TCCCAGCCGCTGCCCGACCTTGG - Intergenic
1019685887 7:2382033-2382055 TCCCCACGGCTGGCGGGCTCAGG + Intergenic
1019701610 7:2477047-2477069 TCCCCTCGCCTGCCAGAGCCTGG - Intergenic
1021116867 7:16754147-16754169 TTCCCACGTCTGCGCGCCCCCGG + Intronic
1027228660 7:76260246-76260268 TCTCCCCGGATGCCCGTCCCTGG + Intronic
1029259653 7:99293108-99293130 TCCCCTCTGCTGCCTGGCCCAGG - Intergenic
1030082214 7:105787967-105787989 TCCACGTGGCTGCCCCACCCCGG - Intronic
1031956862 7:127951409-127951431 TTCCCAAGGCTCCCAGACCCTGG - Intronic
1032545386 7:132737617-132737639 TCCCCACAGCTTCCCTGCCCTGG + Intergenic
1033267312 7:139897349-139897371 TCCCCCCGCCTGCCTGCCCCCGG - Intronic
1034979584 7:155467377-155467399 GCGCCAGGCCTGCCCGACCCAGG - Intergenic
1035373200 7:158392120-158392142 TCCCCACGGAAGCCCCAGCCTGG - Intronic
1035677079 8:1463482-1463504 TACCCGAGGCTGCCTGACCCTGG - Intergenic
1037794263 8:21978675-21978697 TCCCCACTACTGCCAGCCCCAGG - Intronic
1042533146 8:69834495-69834517 TCCCCGCCGCTGCCTTACCCAGG + Intronic
1047946625 8:129887171-129887193 TCCCCAGGGCAGCCAGGCCCTGG - Intronic
1048271383 8:133030872-133030894 TCCACACTGCTGCCCCACCAGGG - Intronic
1048366148 8:133740373-133740395 TCCTCACTGCTGCCCAGCCCAGG + Intergenic
1051638428 9:19202587-19202609 GACCCACAGCTGCCTGACCCAGG - Intergenic
1052818882 9:33123567-33123589 CCCCCAGGGCTGCCCAGCCCAGG + Intronic
1053145199 9:35707235-35707257 GCTCCATGGCAGCCCGACCCTGG + Exonic
1057313252 9:93954516-93954538 TGGCCGCGGCTGCCCAACCCAGG - Intronic
1060820388 9:126658377-126658399 TCCCCCTGGCTGCCGGGCCCGGG + Intronic
1061127982 9:128688997-128689019 TCCCCTCTCCGGCCCGACCCAGG - Intronic
1061609984 9:131739835-131739857 GCCCCGCGGCGGCCCGGCCCGGG - Intronic
1062334314 9:136058327-136058349 TCCCCACGGCTCCCAGTGCCTGG + Intronic
1062551207 9:137087371-137087393 CGCCCACGGCTGCCCCAACCAGG - Intronic
1185469359 X:373496-373518 GCCCCGCGGCTGCCCGACACCGG - Intronic
1186483512 X:9914453-9914475 TTCCCACTGCTCCCCTACCCTGG - Intronic
1189437728 X:41007740-41007762 TCTCCACTGCTGCCCTGCCCTGG + Intergenic
1192222165 X:69204619-69204641 TCCCCATGTCTGCCTGGCCCAGG - Intergenic
1197754379 X:129983966-129983988 ACCCCAGGGCTCCCCCACCCCGG + Intronic