ID: 957946378

View in Genome Browser
Species Human (GRCh38)
Location 3:87068516-87068538
Sequence TCATCTGGATCCACCTCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957946378_957946380 10 Left 957946378 3:87068516-87068538 CCATCAGAGGTGGATCCAGATGA No data
Right 957946380 3:87068549-87068571 TCTCTCTTCCAAGTCTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957946378 Original CRISPR TCATCTGGATCCACCTCTGA TGG (reversed) Intergenic