ID: 957947987

View in Genome Browser
Species Human (GRCh38)
Location 3:87089096-87089118
Sequence TGCCCGGAGTACGGGGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957947977_957947987 -6 Left 957947977 3:87089079-87089101 CCGCAGCCCAGATCTCCTGCCCG No data
Right 957947987 3:87089096-87089118 TGCCCGGAGTACGGGGGCGCGGG No data
957947972_957947987 21 Left 957947972 3:87089052-87089074 CCGGAAGATGCCAGCTCTGCCTG No data
Right 957947987 3:87089096-87089118 TGCCCGGAGTACGGGGGCGCGGG No data
957947971_957947987 22 Left 957947971 3:87089051-87089073 CCCGGAAGATGCCAGCTCTGCCT No data
Right 957947987 3:87089096-87089118 TGCCCGGAGTACGGGGGCGCGGG No data
957947974_957947987 11 Left 957947974 3:87089062-87089084 CCAGCTCTGCCTGGCGCCCGCAG No data
Right 957947987 3:87089096-87089118 TGCCCGGAGTACGGGGGCGCGGG No data
957947976_957947987 -5 Left 957947976 3:87089078-87089100 CCCGCAGCCCAGATCTCCTGCCC No data
Right 957947987 3:87089096-87089118 TGCCCGGAGTACGGGGGCGCGGG No data
957947970_957947987 28 Left 957947970 3:87089045-87089067 CCAGGTCCCGGAAGATGCCAGCT No data
Right 957947987 3:87089096-87089118 TGCCCGGAGTACGGGGGCGCGGG No data
957947975_957947987 2 Left 957947975 3:87089071-87089093 CCTGGCGCCCGCAGCCCAGATCT No data
Right 957947987 3:87089096-87089118 TGCCCGGAGTACGGGGGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957947987 Original CRISPR TGCCCGGAGTACGGGGGCGC GGG Intergenic