ID: 957957142

View in Genome Browser
Species Human (GRCh38)
Location 3:87202049-87202071
Sequence CAGGGAAAAGCCACTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957957136_957957142 -2 Left 957957136 3:87202028-87202050 CCCAAGATAGTTATAGAGTGTCA No data
Right 957957142 3:87202049-87202071 CAGGGAAAAGCCACTGAGGAGGG No data
957957137_957957142 -3 Left 957957137 3:87202029-87202051 CCAAGATAGTTATAGAGTGTCAG No data
Right 957957142 3:87202049-87202071 CAGGGAAAAGCCACTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957957142 Original CRISPR CAGGGAAAAGCCACTGAGGA GGG Intergenic
No off target data available for this crispr