ID: 957957479

View in Genome Browser
Species Human (GRCh38)
Location 3:87207102-87207124
Sequence GCATCCATGTTAACAAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957957477_957957479 28 Left 957957477 3:87207051-87207073 CCAAAATTTAACTGGAAGGAGAT No data
Right 957957479 3:87207102-87207124 GCATCCATGTTAACAAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957957479 Original CRISPR GCATCCATGTTAACAAGAAC TGG Intergenic
No off target data available for this crispr